Abstract
Methicillin-resistant strains of Staphylococcus aureus (MRSA) can harm public health as they can cause widespread food poisoning and resistance to multiple antibiotics. Hence, our objective was to examine the prevalence of S. aureus and MRSA among fish shops, utensils, and workers' hands in Mosul City. We were able to find the nuc and mecA genes in S. aureus and MRSA isolates, respectively, via the PCR approach. In March and April of 2023, one hundred samples randomly selected from fish and various other store surfaces in Mosul were taken for this inquiry. S. aureus isolates the nuc gene, which can be identified in 19% of the samples. The worker hand samples had eight of the top isolates, in contrast to the fish's three isolates out of twenty. Additionally, because the mecA gene existed in 12 of the 19 S. aureus isolates (63.2%), methicillin resistance was shown. The hand samples of the workers had a higher percentage of methicillin-resistant S. aureus isolates 75% (6/8) than other samples. According to the study, a significant amount of S. aureus was showing in fish and associated utensils, revealing that the fishing industry was not suitably subsequent food safety laws. Based on this study, a significant amount of S. aureus was discovered in fish and associated utensils, revealing that the fishing industry was not appropriately following food safety laws.
Keywords
Main Subjects
Highlights
Full Text
Introduction
Seafood, which includes fish, shrimp and oysters, is a high-protein food that is low in calories and saturated fat (1). Fish consumption per person has increased globally over the last few decades (2). Fish, rich in vitamins and minerals, has been demonstrated to have several positive health effects. It delivers vital nutrients throughout prenatal growth and development and lowers the risk of heart illness for people of all ages (1). Nonetheless, fish and fish products, especially those consumed raw or undercooked, are often associated with human illnesses (3). Direct contact with a contaminated aquatic environment and ingested contaminated fish are two possible causes of the presence of various species of bacteria, including harmful pathogens for humans. Therefore, pathogens found in fish reflect the overall health and safety of aquatic ecosystems (4). Seafood-borne illnesses constitute a severe risk to public health both locally and globally. Microorganisms like Escherichia coli, Vibrio spp., Salmonella spp., Listeria spp., Shigella spp., and Staphylococcus spp. are the most frequently implicated in seafood poisoning (5). Twenty-five percent of healthy individuals and animals have asymptomatic Staphylococcus aureus (S. aureus) in their noses and skin, and it has been linked to fish and other seafood products (6). Among the Staphylococcaceae family members, S. aureus seems to be the most invasive species, causing various diseases that frequently result in mortality (7). Indeed, S. aureus is capable of producing staphylococcal enterotoxins (SEs), which positions it as one of the potential foodborne pathogens (8) Correct, the staphylococcal enterotoxins (SEs) produced by S. aureus can cause foodborne illnesses characterized by symptoms such as vomiting and diarrhea. It is essential to note that these toxins are heat-stable, meaning they can withstand cooking temperatures and do not degrade, making proper food handling and hygiene crucial in preventing foodborne illnesses caused by S. aureus (9). Most S. aureus strains (95%) are markedly resistant to penicillin and its derived compounds (10). Methicillin-resistant Staphylococcus aureus (MRSA) is a significant human disease as well as a historically emerging zoonotic pathogen that is significant for both public health and veterinary care. Severe infectious illnesses such as food poisoning, suppurative pneumonia, Osteomyelitis, pyogenic endocarditis, and otitis media are all frequently caused by MRSA in humans (11,12). Clinically, the identification of methicillin resistance in Staphylococcus aureus is commonly done using PCR-based methods to detect the presence of the mecA gene and cefoxitin resistance. This antimicrobial resistance is mainly caused by the penicillin-binding protein, primarily encoded by the mecA gene (13,14). MRSA are hostile zoonotic biovars of S. aureus that meet the requirements for being methicillin- and cefoxitin-resistant. Several phenotypic and molecular characteristics can differentiate methicillin-susceptible S. aureus (MSSA) and MRSA. Non-penicillin antimicrobial classes such as macrolides, fluoroquinolones, aminoglycosides, tetracyclines, and lincosamides are among the many antibiotic classes for which MRSA consistently displays a multidrug resistance pattern (15-17). Consumers who consume products contaminated with MRSA present a severe risk to their health since they may spread resistance to others (18). Few reports about MRSA in fish and fisheries products are available (19).
Therefore, we aimed to find out the occurrence of MRSA in local fish, which may be a source of infection and a public health problem.
Materials and methods
Ethical approval
The research was approved by the Ethics Committee of the College of the Veterinary Medicine /University of Mosul. No. UM.VET.2023.017
Samples collection
The study area was Nineveh Governorate, which included various regions (Al-Maidan district, Hay Al-Suqar, and Al-Nabi Younis district). From March to April 2023, samples of fish skin and local shops, including worker hands, knives, tables, and fish water, were collected. All samples were swabbed with sterilized swabs before being put in tubes with peptone water and pre-enrichment at 37°C for 18 to 24 hours. The samples were then brought in an icebox to the Research Center and Laboratories at Mosul University. After being streaked onto Blood media and Mannitol salt media 7.5% plates, the samples underwent a 24-hour incubation at 37°C.
Gram staining, common biochemical techniques, including catalase and coagulase tests, and morphological appearance (20) were utilized to analyze the typical S. aureus colonies.
DNA Isolation
Positive isolates were cultured on mannitol salt medium for 24 hours at 37°C to isolate the DNA of S. aureus. DNA was recovered using the DNA extraction kit (Qiagen, Hilden, Germany) following the manufacturer's guidelines for Gram-positive bacteria. Using Nanodrop (JenwayTM Genova Nano, UK), the extracted DNA was weighed and kept at -20°C for additional testing.
PCR Reaction
Both the mecA gene and the particular species nuc gene of S. aureus have been identified using the PCR assay. In a 200 μL tube (Biozym, Oldenhorf, Germany) with a total volume of 25 μL, the reaction was carried out using 1 μL of each Forward and Reverse primers (each 10 pmol/L) (Eurofins Genomics, Ebersberg, Germany) (Table 1). The nuc gene has a molecular weight of 166 bp (21) compared to the mecA gene's 147 bp (22). Eight μL of double-distilled water (Promega) and 12.5 μL of 2Go Taq Green Master Mix made up the reaction. Finally, 2.5 l of S. aureus or MRSA DNA template were added to each reaction, and the amplicons were identified utilizing 2% agarose gel and a 100 bp ladder for gel electrophoresis (Peqlab, Erlangen, Germany).
Table 1: Primers and PCR programs for S. aureus (nuc gene) and MRSA (mecA) detection
|
Gene |
Primer |
Sequence (5- 3) |
Fragment size [bp] |
Program* |
Reference |
|
nuc |
nuc-F |
CCTGAAGCAAGTGCATTTACGA |
166 |
I |
(21) |
|
nuc-R |
CTTTAGCCAA GCCTTGACGAACT |
||||
|
mecA |
mecA-F |
GTGAAGATATACCAAGTGATT |
147 |
II |
(22) |
|
mecA-R |
ATGCGCTATAGATTGAAAGGAT |
*PCR program: I: 35 cycles (94°C for 30s, 55°C for 30s, and 72°C for 30s); II: 35 cycles (94°C for 30s, 54°C for 30s, and 72°C for 30s).
Results
Table 2: Number of positive S. aureus in different sample items in fish shops
|
Sample type |
Sample (n) |
Positive n (%) |
|
Fish |
20 |
3 (15%) |
|
Table |
20 |
3 (15%) |
|
Knives |
20 |
2 (10%) |
|
Worker hands |
20 |
8 (40%) |
|
Fish water |
20 |
3 (15%) |
|
Total |
100 |
19 (19%) |
Figure 1: Fragment size of nuc gene (166 bp), lane M: ladder, lane P: +ve control (S. aureus), lane N: -ve control, and lanes 1-5: +ve samples.
Moreover, the results of the PCR assay showed that the mecA gene was present in most S. aureus isolates (MRSA), with a detection rate of 63.2% (12 out of 19). The worker hand samples showed a high percentage of MRSA isolates, with a detection rate of 75% (6 out of 8) that tested positive for the mecA gene. On the other hand, the table and fish water samples had a lower percentage of MRSA isolates at 33.3% (1 out of 3). The percentages of MRSA isolates that were detected in fish and knife samples were 66.7% (2 out of 3) and 100% (2 out of 2), respectively (Table 3 and Figure 2).
Table 3: Number of positive Methicillin-Resistant S. aureus in different sample items in fish shops
|
Sample type |
Sample (n) |
Positive MRSA No. (%) |
|
Fish |
3 |
2 (66.7%) |
|
Table |
3 |
1 (33.3%) |
|
Knives |
2 |
2 (100%) |
|
Worker hands |
8 |
6 (75%) |
|
Fish water |
3 |
1 (33.3%) |
|
Total |
19 |
12 (63.2%) |
Figure 2: Fragment size of mecA gene (147 bp), lane M: ladder, lane P: +ve control (S. aureus), lane N: -ve control, and lanes 1-5: +ve samples.
Discussion
Although the focus of this study was mainly on the fish market environment, it is essential to address the results connected to fish since they reveal substantial implications for the practices of food safety in the fish markets. The findings showed a significant incidence of S. aureus and MRSA contamination in Mosul fish shops.
According to the current study, 19 of 100 (19%) samples were contaminated with S. aureus, and 12 19 (63.2%) were MRSA. Variations in S. aureus and MRSA percentages from very low to high were seen when comparing the global incidences of this pathogen in seafood items. Oh et al. (23) reported a similar percentage (19.8%) of S. aureus in raw fish and the environment in Korea. Furthermore, similar findings have been reported regarding raw fish in Brazil, where higher incidences of 22.2% MRSA were discovered (24). Sivaraman and his colleagues discovered a more significant number of MRSA isolates (50%) in the 174 fish market samples in India (25). However, the prevalence rates of MRSA reported by Hammad et al. (26) and Onmaz et al. (27) were lower than those found by our study at 6.6% and 9%, respectively, in retail fish samples.
A high percentage of S. aureus contamination on utensils and fish samples proves insufficient hygiene practices in the fish shops. Moreover, it is determined that the lack of fish packaging before the sale and the absence of refrigeration when fish is on display for purchase in fish markets are the leading causes of elevated Staphylococcal contamination.
Due to the previously described reasons, it is thought that it is necessary to increase public awareness training for fish workers at every stage of production to reduce the prevalence of infections in fish that harm public health (28). Contamination could result from unclean activities, unsanitary utensils, or an infected handler (29). It is crucial to comprehend that most carriers are asymptomatic and are responsible for the ongoing spread of S. aureus in fish. The likelihood of S. aureus transferring from fish handlers to fish and vice versa is very high (30). According to some research on S. aureus and MRSA, food handlers’ working habits, personal hygiene, and health conditions are generally unfavorable to sanitary standards, which increases cross-contamination in processed fish (26,31). The current research highlights the need for good hygiene practices during all processing stages, from shipping to retail stores, to reduce the hazard of S. aureus and MRSA transfer from fish to consumers (32-34).
MRSA is becoming more prevalent as a result of the widespread use of antibiotics in both humans and animals. Public health professionals, microbiologists, epidemiologists, and veterinary and medical practitioners must work together to defeat MRSA infections. MRSA infections are now resistant to most common commercial antibiotics (35,36). The examination and control of the issue of antibiotic resistance in both humans and animals requires screening resistant bacteria using the antibiotic sensitivity test. Additionally, it is essential to apply alternative-friendly treatment regimens, such as using symbiotic and herbal medicines (37).
Conclusions
These findings highlight the urgent need for improved food safety practices, including rigorous hygiene measures, proper packaging, and appropriate refrigeration, in fish shops and other retail food establishments. Implementing these practices is crucial to minimize bacterial contamination, including S. aureus and MRSA, and to prevent the emergence and spread of strains resistant to antibiotics, ensuring the safety of both consumers and those involved in the meat supply chain. Furthermore, it indicates that the efficiency of the related government agencies in the fish production sector is essential to control these pathogens.
Acknowledgment
We thank the University of Mosul/College of Veterinary Medicine for giving us all the resources to carry out this study.
Conflict of interest
There were no conflicts of interest throughout the writing or data analysis.