Abstract
Antibiotic resistance pathogens are becoming a problem for both humans and animals, as well as environmental health. This study aimed to investigate the occurrence of Enterococcus faecium in the milk of cows infected with clinical mastitis and their antibiotic resistance in Kirkuk province from January to May 2022. Of 81 isolates, Enterococcus species were obtained through conventional culture methods and biochemical tests. Ten isolates 3.3% were identified to the level of E. faecium by standard microbiological methods. The result of the sensitivity test showed that all Ten E. faecium isolates gave multi-antibiotic resistance; the highest percentage of resistance by E. faecium was to Cephalosporin's group 70%, followed by Azithromycin and Streptomycin 60%. The four isolates that gave high levels of antibiotic resistance were selected to investigate resistance genes in them by PCR. norA, tetK, and aac(6') aph(2'') genes are found in all four E. faecium examined isolates, whereas no isolate contains the fexA gene. E. faecium target gene was sequenced, analyzed, and registered in Gen-bank-NCBI and obtained accession number OP566382, which became a reference in Iraq and the world.
Keywords
Main Subjects
Highlights
Full Text
Introduction
Bacterial mastitis is one of the most significant diseases affecting high-production dairy cows, causing high financial losses because it affects the dairy industry; it deteriorates the dairy industry and its quality, in addition to the cost of treatment (1). Enterococcus spp. is one of the formations of normal physiological gut flora in humans and animals; this opportunistic bacterium is considered an environmental factor that causes mastitis, which is found in the enclosing area of the cow, such as the bedding of housing cows, soil, and the waste product of the animals (2,3). The infections are caused mainly by E. faecalis, E. faecium, Enterococcus spp. characterized by their high ability to withstand harsh and different environmental conditions and persist in the environment for long periods, for example, in slaughterhouses, so potential damage of the udder is easy and straightforward (4). Several epidemiological factors can predispose to mastitis, such as season, where winter is a predisposing factor for the infection with mastitis (5). Enterococcus spp. are characterized by a high level of resistance to many antibiotics, both by intrinsic and acquired mechanisms, due to their ability to develop and transfer resistance-determining genes to other bacteria, Enterococcus spp. Serve as a reservoir of antimicrobial resistance genes; another source of concern is the likelihood of enterococci transmission from irritated udder to humans; the increasing use of raw, unpasteurized milk and products derived from this milk appears to imply the risk of potentially pathogenic and antimicrobial-resistant enterococci being transferred to humans via the food chain (6,7). In addition, E. faecium and other lactic acid bacteria have antibacterial ability that can inhibit the growth of other micro-organisms (8). Some Enterococci are inherently resistant to antibiotics as beta-lactam and aminoglycoside groups are considered a medical crisis (9). Polymerase chain reaction assay is a powerful method for detecting the different genes based on the target sequence of the specific gene (10,11).
This investigation was undertaken to evaluate the occurrence of enterococci in the milk of cows with clinical mastitis and to assess their antimicrobial resistance as well as to perform a genetic variation study to identify the polymorphism causing resistance as this study will help to improve understanding of the use of antibiotics in the treatment of mastitis and public health.
Material and methods
Sampling
Three hundred samples were collected from mastitis cow's milk from different places and fields in Kirkuk / Iraq. All animals were subjected to clinical examination; when one or more symptoms were present, the animal was considered to have clinical mastitis. These symptoms included the typical signs of inflammation in udder quarters, signs of a systemic reaction such as fever, depression, and disturbed appetite, and abnormal milk characteristics such as clot formation, discoloration, viscosity, odor, and presence of blood. All of the samples were labeled, aseptically placed in clean, dry, and sterile containers, preserved in an icebox, and then transported to a microbiology laboratory in a veterinary hospital in Kirkuk province to be examined for the presence and isolation of E. faecium.
Isolation and identification
Enterococci isolates were cultured according to standard microbiological methods. The samples were inoculated on the surface of bile esculin agar plates with sodium azide (Oxoid, Basingstoke, Hampshire, England, UK) and then incubated at 37°C for 24-48 h. The characteristic pin-pointed colonies growing on the agar with a zone of black residue and morphologically resembling enterococci were further subjected to presumptive identification based on Gram staining, catalase, oxidase tests and growth in brain-heart infusion broth (BHI) at pH 9.6 - 10 and 45˚C and with 6.5% NaCl, all the isolates were kept in BHI broth with 30% glycerol at -70°C for further analysis (12).
Antibiotic susceptibility
Molecular detection
The material used to extract DNA QIAamp DNA Mini Kit, Catalogue no.51304. The QIAamp DNA Mini Kit provides silica-membrane-based nucleic acid purification from different types of samples. The spin-column procedure does not require mechanical homogenization, so the total hands-on preparation time is only 20 minutes (14).
Oligonucleotide primers used in cPCR
Nine pairs of primers were supplied from Metabion (Germany). They have specific sequences and amplify particular products (Table 1).
Table 1: Oligonucleotide primer sequences used in the study
|
Gene |
Primers (5'-3') |
Molecular weight |
Reference |
|
TetK |
GTAGCGACAATAGGTAATAGT |
360 bp |
(15) |
|
GTAGTGACAATAAACCTCCTA |
|||
|
aac(6')aph (2'') |
GAAGTACGCAGAAGAGA |
491 bp |
(15) |
|
ACATGGCAAGCTCTAGGA |
|||
|
FexA |
GTACTTGTAGGTGCAATTACGGCTGA |
1272 bp |
(16) |
|
CGCATCTGAGTAGGACATAGCGTC |
|||
|
NorA |
TTCACCAAGCCATCAAAAAG |
620 bp |
(17) |
|
CTTGCCTTTCTCCAGCAATA |
|||
|
VanA |
CATGACGTATCGGTAAAATC |
885 bp |
(18) |
|
ACCGGGCAGRGTATTGAC |
|||
|
VanB |
GTGACAAACCGGAGGCGAGGA |
433 bp |
(19) |
|
CCGCCATCCTCCTGCAAAAAA |
|||
|
MphC |
GAGACTACCAAGAAGACCTGACG |
722 bp |
(20) |
|
CATACGCCGATTCTCCTGAT |
|||
|
BlaZ |
TACAACTGTAATATCGGAGGG |
833 bp |
(21) |
|
CATTACACTCTTGGCGGTTTC |
|||
|
E. faecium adk |
TATGAACCTCATTTTAATGGG |
437 bp |
(22) |
|
GTTGACTGCCAAACGATTTT |
Results
According to phenotypic criteria, 81 isolates were obtained; they all grew on bile aesculin agar and yielded the typical pin-pointed colonies of enterococci with a zone of black residue, proving that they were tolerant to 40% bile and hydrolyzed esculin. All the isolates were presented microscopically as Gram-positive ovoid cocci arranged chiefly in pairs or short chains. Further confirmation of the recovered isolates revealed that they were catalase test negative, Fermentation of sugar (lactose, fructose, glucose, and arabinose) cheerful, tolerant to high salinity and extreme pH (grew on BHI broth with 6.5% NaCl and at pH 9.6) and exhibited visible growth at ten and 45°C. Differential biochemical tests were carried out for all suspected isolates to investigate the enterococci to the species level and to exclude other bacterial species that are similar to them in some characteristics. Nineteen isolates were supposed to be positive for E. faecium. The cconfirmatory test was conducted by PCR to identify E. faecium by specific primers (E. faecium adk), which produced bands on agarose gel at the position of 437 bp (Table 2 and Figure 1). The results showed that only ten isolates were positive for E. faecium 3.3%.
Table 2: The percentage of E. faecium strains in the collected samples
|
Samples |
Total samples (n) |
+ve sample (%) |
|
Milk |
300 |
10 (3.3) |
Figure 1: Agarose gel photo documentation for molecular identification of E. faecium lane L molecular weight marker (100 -1000bp) lane pos: positive control (at 437 bp.), lane neg.: negative control, lanes 1, 4, 5, 8, 9, 14, 15, 16, 18, and 19 are positive isolates.
The results of the antimicrobial susceptibility test by disc diffusion technique for all positive E. faecium isolates showed that high levels of multi-resistant E. faecium isolates are of grave concern, with the isolation of three strains resistant to vancomycin at 30%. The highest level of resistance was against the cephalosporins by 70%, while the level of resistance was the lowest against amoxicillin clavulanic by 20%. For the quinolones group levofloxacin, the result showed a low resistance level of 20%, while the resistance level of E. faecium strain to ciprofloxacin was 40%. As for the phenol group, the result showed a resistance ratio: florfenicol by 40% and chloramphenicol by 30%. For the aminoglycoside group, the result showed a high level of streptomycin resistance by 60%, while only three isolates showed gentamycin resistance by 30%. Tetracycline E. faecium strain as 50%. Finally, the result showed a high resistance to azithromycin by 60% (Table 3). Through the sensitivity test results, the four isolates that gave high multi-antibiotic resistance were selected to investigate resistance genes in them by PCR to identify the polymorphism causing multi-antibiotic resistance (Figures 2 and 3).
Table 3: The antibiogram of E. faecium Resistance isolates from mastitis cow’s milk samples
|
Class |
Antibiotic |
Resistance n(%) |
|
Glycopeptide |
Vancomycin |
3 (30) |
|
Tetracycline's |
Tetracycline |
5(50) |
|
Aminoglycoside |
Gentamycin |
3(30) |
|
Streptomycin |
6(60) |
|
|
Macrolides |
Azithromycin |
6(60) |
|
Quinolones |
Levofloxacin |
2(20) |
|
Ciprofloxacin |
4(40) |
|
|
Phenicol |
Chloramphenicol |
3(30) |
|
Florfenicol |
5(50) |
|
|
B-lactamase |
Amoxicillin |
2(20) |
|
Cefoxitin |
7(70) |
Figure 2: Distribution of Antibiotic resistance of E. faecium isolates from mastitic cows' milk.
Figure 3: The antibiogram assay for determination of multi-antibiotics resistance genes of E. faecium isolates from mastitis cow milk
PCR examination results showed that the resistance genes norA, tetK, aac(6')aph (2'') found in all E. faecium isolates as 100%, mphC, and VanA gene found as 50%, blaZ, and vanB found as 25%, whoever fexA genes which is responsible for E. faecium resistance to phenetoles did not found in any one of E. faecium isolates. Still, the sensitivity test results showed that E. faecium resistance to florfenicol and chloramphenicol was 40 and 30%, respectively (Table 4 and Figure 4).
Table 4: The incidence of some resistance genes for E. faecium strains from mastitic cow’s milk by using of PCR technique
|
Sample NO. |
blaZ |
tetK |
phC |
fexA |
norA |
aac(6')aph (2'') |
VanA |
VanB |
|
14 |
- |
+ |
+ |
- |
+ |
+ |
- |
- |
|
4 |
+ |
+ |
- |
- |
+ |
+ |
+ |
- |
|
8 |
- |
+ |
+ |
- |
+ |
+ |
+ |
+ |
|
19 |
- |
+ |
- |
- |
+ |
+ |
- |
- |
|
% |
25% |
100% |
50% |
0 |
100% |
100% |
50% |
25% |
Figure 4: Agarose gel electrophoresis of PCR amplified products of Enterococcus faecium mphC resistance gene at 722 bp (A), E. faecium norA resistance gene at 620 bp (B), E. faecium blaZ resistance gene at 833 bp (C), E. faecium fexA resistance gene at 1272 bp (D), E. faecium aac6 resistance gene at 491 bp (E), E. faecium vanA resistance gene at 885 bp (F), E. faecium (tet K) resistance gene at 360 bp (G), and E. faecium vanB resistance gene at 433 bp (H). lane L molecular weight marker, lane pos.: positive control, lane neg.: negative control, the size in base pairs (bp.) of each PCR product is indicated for the bands.
When conducting a sequencing procedure on isolate No. 8 of E. faecium, which gave a high degree of multiple resistance against antibiotics and showed through the results of the PCR examination that it carries various resistance factors, it was found that the local gene of the isolate that bearing the accession number OP566382 (E. faecium Mah-2), is close to the global standard gene of E. faecium by 97-100% in comparison with the previous isolates registered in the Gen Bank that gave similarity (Figures 5 and 6).
Figure 5: Phylogenetic tree of the local genome of E. faecium sequencing isolate from mastitic cows milk.
Figure 6: Alignment of multiple sequences of the local genotype of E. faecium isolate from mastitic cows milk.
Discussion
Enterococci are highly resistant to many antibacterial substances by intrinsic and acquired mechanisms (23). Recently, antibiotic resistance has attracted the attention of researchers and has been investigated in several studies (24,25). Several authors have demonstrated the prevalence of Enterococcus spp. in dairy cattle with mastitis and in raw milk (26-28). In this study, E. faecium represented 3.3%; this agreement with the study by Rozanska (29), who isolated E. faecium from mastitis cow’s milk as 2%, and considered lower than the study by LI (30), who isolated E. faecium from mastitis cow’s milk as 20%. Kim (31) recorded the prevalence of E. faecium from mastitis cow milk at 13%; this disparity could be attributed to the incidence of E. faecium in different countries, farm management, and climate conditions. According to data recorded in Table 3, antimicrobial susceptibility results showed high levels of contamination with multi-resistant E. faecium of grave concern, with the isolation of strains resistant to vancomycin at 30%. The highest resistance level was observed to Cefoxitin at 70% and about 60% for each of Azithromycin and Streptomycin. The result showed a middle level of resistance at 50% for each Florfenicol and Tetracycline, while the lowest level was for Amoxicillin-clavulanic and Levofloxicillin by 20%. For Gentamycin 30%, Chloramphenicol 30% and Ciprofloxacin 40%. Enterococci exploit several intrinsic and acquired antibiotic resistance mechanisms (32,6). Rozanska (29) found E. faecium resistant to Vancomycin by 3%, contrasting with our result. Our result, considered lower than EL-zaman (33), found that Vancomycin-resistant E. faecium by 66%. Tekin (34) recorded that 7 (88%) E. faecium isolates were positive for van genes, but there was no Vancomycin resistance in all of the isolates. Also, Kim (31) recorded no E. faecium Vancomycin resistance by 0%. Many studies found E. faecium resistance to B-lactam in high levels (9,35), which agrees with our Cephalosporin result. Our results showed E. faecium resistance to phenicol, although the results of the PCR examination showed that none of the E. faecium isolates had the fexA gene, which is responsible for E. faecium resistance to phenicols. This resistance may be due to the common and prolonged usage of these antibiotics in the dairy industry for prophylaxis and treatment of mastitis-diseased cattle. Our result agrees with Montiron (36), who found E. faecium resistance to Chloramphenicol as (40%); our impact is considered higher than the result in studies conducted by Kim and Olivera (31,37) by 9 and 0%. The report given by Kuyucuoğlu (38) mentioned that E. faecium resistance to Tetracycline was 62%, which is almost similar to our result, lower than the result in Chain by Yang (39), who recorded Tetracycline resistance by 88%. A study in Korea by Know (40) found resistance to ciprofloxacin at 69%, which is higher than our result. Finally, streptomycin resistance is mentioned in the study by Jackson (41) by 1%, which contrasts with our development. Generally, enterococci antibiotic resistance levels vary by species, drug, and country (29). NCBI analyzes sequencing results to know the genetic variation, which shows that the local genome of E. faecium isolate is close to HE681086 in Saudi Arabia, ON729291 in India by 100%, while CP083695 in China, AP013036 in Japan is the furthest in the phylogenic tree.
Conclusion
Multi-antibiotic resistance enterococci are a severe hazard to both cattle and owners because they increase the cost of disease treatment and sometimes result in fatalities. In this study, multi-antibiotic resistance E. faecium is prevalent in Kirkuk- Iraq, during winter and might spread further if preventative steps are not taken. Moreover, E. faecium isolated from mastitis cow's milk is becoming resistant to an increasing number of antibiotics due to inappropriate use of antibiotics and an insufficient treatment period.
Acknowledgment
The authors thank the College of Veterinary Medicine, University of Baghdad.
Conflict of interest
No conflict of interest.