Abstract
Coccidiosis is an intestinal disease caused by a parasite of the genus Eimeria. This parasite mainly affects poultry species and causes great economic losses in the poultry industry. This study was designed to estimate the prevalence of coccidiosis in the local breed of domestic chicken in Nineveh Governorate, Iraq. 450 faecal swabs and intestinal samples (intestinal scraping) were collected from different local breeds of home-bred chickens from October 2020 to the end of March 2021. All fecal samples were examined using the flotation method by using sugar solution, and Eimeria was confirmed by the polymerase chain reaction method. Fecal examination results showed that 32.6% of the total samples were positive for Eimeria oocysts, classified into six species including E. brunetti, E. mitis.E. maxima E. acervulina E. necatrix, E. tenella with infection rates are 57.5, 44.2, 42.1, 26.5, 20.4, 16.3%, respectively. The phenotypic results were genetically confirmed by the result of the reaction of 455 base pairs. The prevalence of coccidiosis was highest in chickens less than three months of age 49.2% and lowest in chickens older than 6 months 23.9%
Keywords
Main Subjects
Highlights
Article Highlights:
Full Text
A.M. Ahmed and H.S. Albakri
Department of Veterinary Microbiology, College of Veterinary Medicine, University of Mosul, Mosul, Iraq
[email protected], 0000-0003-4423-2973
[email protected], 0000-0002-7727-1621
2021-06-12
2021-06-30
Abstract
Coccidiosis is an intestinal disease caused by a parasite of the genus Eimeria. This parasite mainly affects poultry species and causes great economic losses in the poultry industry. This study was designed to estimate the prevalence of coccidiosis in the local breed of domestic chicken in Nineveh Governorate, Iraq. 450 faecal swabs and intestinal samples (intestinal scraping) were collected from different local breeds of home-bred chickens from October 2020 to the end of March 2021. All fecal samples were examined using the flotation method by using sugar solution, and Eimeria was confirmed by the polymerase chain reaction method. Fecal examination results showed that 32.6% of the total samples were positive for Eimeria oocysts, classified into six species including E. brunetti, E. mitis.E. maxima E. acervulina E. necatrix, E. tenella with infection rates are 57.5, 44.2, 42.1, 26.5, 20.4, 16.3%, respectively. The phenotypic results were genetically confirmed by the result of the reaction of 455 base pairs. The prevalence of coccidiosis was highest in chickens less than three months of age 49.2% and lowest in chickens older than 6 months 23.9%
Keywords: Cocccidiosis, Eimeria species, Diagnosis, Prevalence
تحدید النمط المظهری والوراثی لأنواع الایمیریا فی دجاج التربیة المنزلیة فی محافظة نینوى، العراق
عدنان محمد أحمد و هیثم صدیق البکری
فرع الأحیاء المجهریة، کلیة الطب البیطری، جامعة الموصل، الموصل، العراق
الخلاصة
یعد داء الکوکسیدیا مرضا معویا یسببه طفیلی یعود لجنس الایمیریاویصیب هذا الطفیلی بشکل رئیسی أنواع الدواجن ویتسبب فی خسائر اقتصادیة کبیرة فی صناعة الدواجن. صممت هذه الدراسة لتقدیر نسبة انتشار الکوکسیدیا فی السلالة المحلیة من الدجاج المنزلی فی محافظة نینوى، العراق. إذ تم جمع 450 مسحة برازیه وعینة معویة (کشط معوی) من سلالات محلیة مختلفة من دجاج التربیة المنزلیة من شهر تشرین الأول 2020 إلى نهایة شهر اذار2021. تم فحص جمیع عینات البراز باستخدام طریقة التطویف بالمحلول السکری وتم تأکید الإصابة بجنس الایمیریا باستخدام طریقة تفاعل السلسلة المتبلمر. أظهرت نتائج فحص البراز أن 32.6٪ من مجموع العینات کانت موجبة بأکیاس بیض الایمیریا، مصنفة إلى ستة أنواع تشمل E. brunetti E. mitis.E. maxima E. acervulina E. necatrix, E. tenella وبنسب إصابة 57.5، 44.2، 42.1، 26.5، 20.4، 16.3٪ على التوالی. تم تأکید النتائج المظهریة وراثیا وبواقع ناتج تفاعل455 زوجا قاعدیا. کانت نسبة انتشار الکوکسیدیا الأعلى فی الدجاج الذی بعمر أقل من 3 أشهر 49.2٪ وأقل نسبة فی الدجاج الأکبر من 6 أشهر 23.9٪.
Introduction
There are many parasitic diseases, which affect in backyard poultry which are due to poor management (1). Avian coccidiosis is enteric disease caused by protozoan parasite of the genus Eimeria phylum Apicomplex caused significant economic losses in poultry industry worldwide which annually estimated about three billion dollars due to of high incidence of morbidity and mortality lead to low productivity, lack of growth, animal death, costs of treatment and disease control (2). The disease occurs associated with poor management by ingestion the sporulated oocysts of contaminated food and water (3). The disease clinically characterized by diarrhea develop to bloody diarrhea due to acute intestinal inflammation and, low feed conversion rate, poor growth, low production, and high morbidity and mortality. In poultry there are seven important species belonges to genus Eimeria (E. brunetti, E. maxima, E. necatrix, E. tenella, E. mitis, E. acervulina and E. praecox) characterized by high degrees of host and site specificity (4). For example, E. tenella consider to be most pathogenic and wide spread in chicken compared with other species in Poultry (5). Phenotypically there are different criteria used previously for identification and characterization of Eimeria species such as parasitized intestine zone, gross appearance of the lesion, oocyst morphology, minimum sporulation period, minimum prepatent time, parasite location in the intestinal epithelium, and cross-immunization tests (6,7).
The present study was designed to estimate the prevalence of coccidiosis in local breed of backyard chicken in Ninevehgovernorate, Iraq using phenotypic (morphological) and genotypic (PCR) methods to identify the species and genus of Eimeria.
Material and methods
Sample collection
A total of 450 samples of fresh fecal swabs (n=390) and intestine contain (intestinal scraping smear) (n=60) were collected randomly from backyard chicken from different locations in Ninevehgovernorate, Iraq. The study was conducted from October 2020 to March 2021. Fresh fecal samples were collected using spatula and preserved in a clean polypropylene tube. The samples were labelled with the name of farm (owner), location of the farm, date of collection, and health status. Samples were transported to the laboratory of Department of Microbiology, University of Mosul, Mosul, Iraq and kept in 4ºC until further analysis.
Phenotypic (morphological) examination
Microscopic identification of Eimeria spp in the present study was based on following criteria: size (length and width µm/µm) and shape of oocyst, presence or absence of micropyle, sporulation time and location of lesion in the gut. The intestine (duodenum, jejunum, ileum, large intestine: caeca) was opened and gross examination of pathological lesions were recorded and sample was scraped. All fecal swabs and intestinal content samples were examined microscopically by simple floatation technique using saturated sugar solution as described by Urquhart et al (8). Of each sample 25 oocytes at least were examined morphometrically and oocyst was measured (length and width µm/µm) using calibrated ocular microscope at X40 magnification (9). The statistical analysis of oocytes measurements of size (length and width µm/µm) were analyzed using the Ocular Micrometer under the magnification power of 40 x and the true dimensions of the egg sack were found according to the following equation: true egg sac dimensions = measurement of egg sac dimensions in the planned eyepiece × microscope factor (6).
Sporulation of parasite
Oocyst positive samples were diluted into 2.5% aqueous potassium dichromate (K2Cr3O7) and kept in Petri dishes for sporulation using shaker water bath at 29ººC. The K2Cr3O7 solution 2.5% was used to provide sufficient moisture and destroyed other bacteria. After sporulation, oocysts were recovered by centrifugation with saturated sugar solution as described by Duszynski and Wilber (10) and used in subsequent analysis. Microscopic examination was performed at various times to determine the sporulation of oocysts (4). The shape (length/width) of the sporulated oocysts were determined by using the method for species identification as described by Hadipour et al(11). The calculated oocysts shape index values were then compared with the standard diagnostic guide provided by Teixeira and Lopes (12) to determine the species encountered in the study.
Nucleic acid extraction
DNA was extracted from oocysts of Eimeria spp using QIAamp fast DNA Stool Mini Kit in accordance with the recommended procedure of manufacturer (Qiagen, Hilden, Germany as following. A total of 220 µg of fresh feces was initially suspended in 1 mL inhibit buffer (Qiagen) and incubated for 5 min at 70ºC with vortexed intervals for 15s. The suspension was centrifuged at 900×g for 1 min and 200 µL of supernatant was transferred in to 1.5 mL Eppendorf tubes. Afterwards, proteinase K (15 µL) and 200 AL lysis buffer (Qiagen, Hilden, Germany) were added and the suspension was incubated at 70ºC for 10 min. This was then heated at 70ºC for 10 min, then 200 µL of absolute ethanol was added and vortexed. Final suspension was treated with spin column (Qiagen) following the manufacturer’s instructions. The purified DNA was quantified using NanoDrop (Thermo Fisher Scientific, Darmstadt, Germany).
Eimeria-based PCR assay
The DNA was further confirmed by protocol targeting of the 18S rRNAgene using universal PCR primers (Forward primer: CGCGCAAATTACCCAATGAA and revers primer: ATGCCCCCAACTGTCCCTAT) as described by Hinsu etal (13) resulting in an amplicon of ~455 base pairs. The gDNA was used as template for PCR amplification. Each 20 μL PCR reaction mixture comprised of 2 μL gDNA, 1 μL of each forward and reverse primer 10 pM, 10 μL Master Mix (Eurofins Genomics, Germany) and 6µL aqua dest. PCR amplification cycles were: initial denaturation at 95ºC for 10 min, followed by 35 cycles of 95ºC for 45s, 65ºC for 10s and 72ºC for 12s, and a final extension at 72ºC for 40s. The amplified PCR products were electrophoresed on 1.5 agarose gel matrix (Biozym, Hessisch-Oldendorf, Germany), stained in ethidium bromide 0.5 μg mL-1 and visualized at 302 nm on a UV transilluminator using the Geldoc 2000 gel documentation system (BioRad, Munich, Germany).
Result
A total of 147 (32.6%) from 450 fecal and intestinal contain samples were phenotypically positive of Eimeria spp oocysts. The highest prevalence rate was recorded March and lowest was in October with significant difference (Table 1). Six different Eimeria species were recorded including: E. tenella 57.5 %, E. necatrix 44.2%, E. acervulina 42.1%, E. maxima 26.5%, E. mitis 20.4% and E. brunetti 16.3%, respectively (Table 2). Mixed infection with more than two species of Eimeria was recorded. Morphological Characterization of oocysts of sporulated and nonsporulated oocyst was illustrated in (Fiqure1, 2, 3, 4, 5, 6). The prevalence rate was higher in chicken of age < 3 month and lower in chicken of age > 6 months (Table 3). According to the clinical signs the prevalence rate of Eimeria oocytes were observed in Backyard chicken was clinically healthy and no signs of disease were recorded (Table 4). The sporulation time was recorded as following: E. maxima after 30 h, E. mitis and E. acervulina after 18 h and E. necatrix, E. tenella, E. brunetti after 20 h. and the morphometric form of Eimeria oocyst (Table 5). The of molecular results revealed that all the samples investigated in the present study showed amplification size 455 bp of genus Eimeria which was considered positive PCR reaction (Figures 1-7).
Table 1: Distribution of positive Eimeria oocyst in backyard chicken in the present study
|
Periods |
Number |
Number (%) of positive |
|
10.2020 |
85 |
20 (23.5) |
|
11.2020 |
75 |
30 (40) |
|
12.2020 |
65 |
17 (26.1) |
|
01.2021 |
70 |
16 (22.8) |
|
02.2021 |
80 |
29 (36.25) |
|
03.2021 |
75 |
35 (46.6) |
|
Total |
450 |
147 (32.6) |
Table 2: Percentage of six Eimeria species identified backyard chicken in the present study
|
Species |
Number (%) of positive samples |
|
E. tenella |
84 (57.5) |
|
E. necatrix |
65 (44.2) |
|
E. acervulina |
62 (42.2) |
|
E. maxima |
39 (26.5) |
|
E. mitis |
30 (20.4) |
|
E. brunetti |
24 (16.3) |
Table 3: Distribution of coccidiosis according to the age of backyard chicken investigated in the present study
|
Age of chicken |
Number (%) |
|
|
examined samples |
+ve samples |
|
|
> 3 months |
126 |
62 (49.2) |
|
3-6 months |
119 |
36 (30.2) |
|
< 6 months |
205 |
49 (23.9) |
|
Total |
450 |
147 (32.6) |
Table 4: Prevalence of coccidiosis in backyard chicken according to clinical signs
|
Eimeria |
Oocyst size (µm) |
Mean of Width and length (µm) |
Sporulation time (h.) |
Morphology of oocyst |
Site of infection |
Gross lesion |
|
E. tenella |
19.57×22.5 |
17-22× 25.5-20 |
20 |
Ovoid, thin smooth wall |
Caecum |
Hemorrhagic and filled with clotted and unclotted blood |
|
E. necatrix |
16.7×19.1 |
12.5-18 × 22.5-14 |
20 |
oblong ovoid, thin wall |
Jejunum |
Petechial hemorrhage and mucoid |
|
E. acervulina |
15.23×19.2 |
17.9-21.5 × 14.2-16 |
18 |
Ovoid, thin smooth wall narrow anterior end |
Duodenum |
Congestion and thickening of mucosa with whitish transverse lesion |
|
E. brunetti |
19.74×23.4 |
21-28.2 × 18.5-22 |
20 |
Ovoid, thick, brown wall |
Ileum |
Mucoid content and thickening of mucosa |
|
E. maxima |
22.3 × 28.5 |
23-30.5 × 18-24 |
30 |
Large ovoid, thick wall, yellow- brown |
Jejunum and Ileum |
Petechial hemorrhage and thickening of intestinal wall |
|
E. mitis |
14.7×15 |
11.5-17.5× 12.5-18 |
18 |
Sub spherical, thin wall |
Ileum |
Enteritis |
Table 5: Morphological and morphometric characterization of Eimeria species in backyard chicken
|
Diarrhea |
No. examined |
No. (%) positive |
|
Without diarrhea |
334 |
121 (36.22) |
|
With diarrhea |
116 |
26 (22.41) |
|
Total |
450 |
147 (32.6) |
Figure 1: Sporulated and nonsporulated oocyst of E. tenella (40X).
Figure 2: Sporulated and nonsporulated oocyst of E. acervulina (40X).
Figure 3: Sporulated and nonsporulated oocyst of E. necatrix (40X).
Figure 4: Sporulated and nonsporulated oocyst of E. mitis (40X).
Figure 5: Sporulated and nonsporulated oocyst of E. brunetti (40X).
Figure 6: Sporulated and nonsporulated oocyst of E. maxima (40X).
Figure 7: Agarose gel electrophoresis of 18S rRNA gene of genus Eimeria showing amplification product size ca. 455 bp. M: Marker 100 bp. Wells 1-18 are positive samples, well 19 is negative control.
Discussion
In present study the prevalence of coccidiosis in local breed of backyard chicken was 32.6 %, the result was agreement with Kabouudi etal (14) and Nnadi and George (15) were recorded 31.8% and 35.5% of coccidiosis in local breed chicken in Tunisia and Nigeria (11), respectively. In Turkey (16), in Ethiopia and in Egypt (17) were recorded the coccidiosis in 54.3%, 64%, 53.6% and 21.24% in chicken. These differences in prevalence rates could be attributed to the conditions of breeding, the study area, the efforts made to control the disease, the different climatic and environmental conditions from one region to another, the season of sample collection during the year, in addition to the difference in the number of samples examined and the ages of the chickens examined (18).
Diarrhea is a major clinical sign of coccidiosis in the chicken (19) and it is worth mentioning the prevalence of subclinical coccidiosis in backyard chicken in the present study was significantly higher than clinical coccidiosis which considered as carrier of oocyst without showing any signs of disease. Previous studies also mentioned that subclinical coccidiosis in local breed chicken are most prevalent and acting a source of infection and also effect on production performance of chicken (20). This attributed to repeated exposure to different species of Eimeria and development of immunity against the parasite. These birds are become a source of oocyst fecal shedding and lead to contaminate of surrounding farm environment (e.g. housing surfaces, pasture, water, feed, soil, and more others).
In the present study six Eimeria species were identified and this species were recorded also previously (21). The most prevalent species was E. tenella 57.5% which agreement with other previous studies (5,15,22). But other previously study reported that E. acervulina, and E. tenella are most prevalent species (23). In the present study mixed infection with more than two Eimeria species was observed in local breed chicken as reported previously (24).
In the present study, the age of local breed of chicken was studied as one of the main factors in the incidence and spread of coccidiosis in poultry, but Eimeria species can be infected all live of bird in different ages (25). The higher prevalence of coccidiosis in young chicken 0-3 months compare with chicken >6 months this result was agreementwith Wondimu etal (26) who reported high incidence of coccidiosis in young bird.
Highest prevalence rate of infection recorded in March while lowest infection rate was in October. This may be attributed to the relative moderation of temperatures in this month, with the presence of humidity and rainfall that provides adequate conditions for the sporulation of Eimeria oocyst and occurrence of infection. This finding was agreement with Wondimu et al (26) who mention that occurrence of coccidiosis increase in rainy months of the year.
The morphology of oocyst and sporulation time and gross lesion may help in identification of Eimeria species in present study oocyst length, width and morphology were an indicative for Eimeria species identification. Most of Eimeria oocysts were identified in ovoid shape which agreement with Soulsby (9) which reported the length and width of E. tenella was 19.5-26 and 16.5-22.8 µm (20) were reported that length and width E. acervulina 15.7-20.3 and 14.5- 18.6 µm and E. maxima 27.9-34.5 and 18.6-26.4 µm and E. brunetti 20.6-26.3 and 16.9-21.6 µm.
Conclusion
This study is mainly concluded that demonstration of the Eimeria species parasite in digestive system of backyard chicken by using microscopy and nested PCR associated with the characteristic of some species of Eimeria, in addition to the effect of infection on backyard chickens and the percentage of the parasite during the seasons of the year, as well as the rate of infection related to the age of backyard chickens by diagnosing the most important Eimeria species.
Acknowledgments
The authors would like to thank the Dean of College of Veterinary Medicine, University of Mosul, and to the whole staff in the Department of Microbiology for their efforts and supports to complete this research.
Conflicts of Interest
The authors declare that there are no conflicts of interest regarding the publication of this manuscript.
27. Wondimu A, Mesfin E, Bayu Y. Prevalence of poultry coccidiosis and associated risk factors in intensive farming system of Gondar Town, Ethiopia. Vet Med Inter. 2019. DOI: 10.1155/2019/5748690