Abstract
Food safety and forensic applications rely seriously on identifying meat samples of unknown species. Mutton meat is delicious and high-priced meat. Its tallow is a flavoring precursor to being authenticated by using different meat species. Mutton authenticity by beef meat that is genetically related to each other makes it difficult to detect fraud of products, mainly if the substitution is applied with fat, not only meat. So, accurate methods for detection must be applied to evaluate meat fraud based not only on protein but also on fat substitution. This work aimed to evaluate the mutton meat substitution by meat and fat of beef using multiplex PCR and Gas Chromatography-Tandem Mass Spectrometry (GC/MS/MS). Multiplex PCR detects cytochrome b in mutton meat adulterated with different concentrations of beef meat, even with 0.5%. PCR products amplified at 274 bp for mutton and 271 bp for beef. Fatty acid profile of pure mutton meat (tallow) samples and mutton authenticated with beef meat by GC/MS/MS. It was found that it contained 39.48 mg/100 g of total saturated fatty acids (TSFA), 60.48 mg/100 g of total unsaturated fatty acids (TUSFA), and 3.4 mg/100 g of trans-fatty acids (TFA). While after being authenticated with beef, these results changed to 49.58, 49.57, and 6.37 mg/100gm for TSFA, TUSFA, and TFA, respectively. In conclusion, Multiplex PCR and GC/MS/MS evidenced to be accurate and applicable for the recognition of mutton meat authentication.
Keywords
Main Subjects
Highlights
Full Text
Introduction
Many researchers in the fields of Food Hygiene and Veterinary Forensic Medicine in Egypt have been increasingly interested in the adulteration of food, especially meat (1-3). Mutton meat is one of the most delicious and predominant foods to many consumers worldwide as it contains high-quality protein, low cholesterol, and low fat (4). Some consumers prefer mutton products over other meat due to their better sensory attributes (5). Sheep considers common livestock that spread all over the world (6). The national production of 64,758 tons of mutton in 2020 failed to meet the demand, and an inventory of 8.7 million heads was created (7). Mutton has the highest price compared to other meat, changing between 20 and 40 USD/kg (8). Egyptian consumers prefer mutton meat products such as kebab and kofta, which have a higher price than those of beef origin. This mutton product's higher price gives the reason for some illegal traders to substitute other meat species in these products. Mutton products can be substituted by using only mutton tallow with other meat, such as beef, to produce the flavor of mutton products. Several studies confirmed that the fat of animals is the primary precursor for meat flavor (9,10). Mixing or replacing meat products with other ingredients without labeling considers the authenticity or fraud of food at any step of processing (11). Authenticity or fraud of food considers a severe problem and a threat to health, economic, legal, and religious concerns (12,13). Moreover, it leads to losing trust and confidence between consumers and food safety regulators. Hence, methods for the detection of fraud are required for food inspectors and also, consumers. Many methods have been used for meat fraud detection, such as polymerase chain reaction (PCR), which is a faster and more reliable molecular method (14), real-time PCR (15), and advanced mass spectrometry (MS) methodologies that consider a novel analytical method for detection of food authentication due to its accuracy and sensitivity (16).
Mutton authenticity by beef meat that is genetically related to each other makes it difficult to detect fraud of products, mainly if the substitution is applied with fat, not only meat. So, accurate methods for detection must be applied to evaluate meat fraud based not only on protein but also on fat substitution. This work aimed to evaluate the mutton meat substitution by meat and fat of beef using multiplex PCR and GC/MS/MS.
Materials and methods
Ethical approve
The current work followed the guidelines of The Animal Care Committee, Faculty of Veterinary Medicine, Benha University, Egypt. Ethical number: BUFVTM 20-9-22.
Samples collection and preparation
Fresh meat specimens (mutton and beef) were collected from Al-Basateen Central Abattoir of Cairo, Egypt. Samples were minced and prepared as pure beef meat (100%), pure mutton meat (100), mutton authenticated with beef 0.5%, mutton authenticated with beef 5%, mutton authenticated with beef 30%, and mutton authenticated with beef 50% to be examined by multiplex PCR. While for GC/MS/MS, fatty acid profile evaluation samples were prepared as pure mutton meat (100), pure beef meat (100%), and a mixture of beef and mutton (50%).
Extraction of DNA
QIAamp DNA Mini Kits (Qiagen - Labsave, Germany, Catalogue no. 51304) were used for DNA extraction and purification from the meat specimens. Using silica membranes, different samples can be purified with the QIAamp DNA Mini Kit. It takes only 20 minutes to prepare spin columns without mechanical homogenization. Each sample (25 mg) was incubated overnight at 56 ˚C with 180 μl of ATL buffer and 20 μl QIAGEN protease into the bottom of a 1.5 ml microcentrifuge tube till tissue lysis, then incubated at 72 ˚C for 10 min. The mixture was centrifugated at 4000 rpm for 2 minutes to eliminate drops from the inside of the lid. Transfer the supernatant was diluted with ethanol 96%. The mixture was then put into a QIAamp DNA mini spin column. The DNA attached to the column was washed twice in 2 centrifugation stages using 2 distinct wash buffers. 50 μl buffer AE, pure DNA was eluted from the column to enhance the purity of the eluted DNA. The Spectrophotometer was used to determine the content and purity of DNA (Biometra, Germany) at 260 and 280 nm, respectively (to obtain the ratio of the absorbance) (13). DNA fragments were separated electrophoretically at 100 V for 60 min. A 100 bp plus DNA Ladder (Qiagen, Germany, GmbH) was used to determine the size of the fragments.
Cytochrome-b gene primers
Samples were extracted and examined following Doosti et al. (14) depending on the evaluation of the cytochrome-b (Cyt-b) gene in examined samples (Table 1).
Table 1: The sequence of Cytochrome-b gene primers for sheep and beef
Species |
Primer Sequence 5'-3.' |
Expected size |
Reference |
Sheep |
Forward: ATGCTGTGGCTATTGTC Reverse: CCTAGGCATTTGCTTAATTTTA |
274 bp |
Doosti et al. (14) |
Beef |
Forward: GCCATATACTCTCCTTGGTGACA Reverse: GTAGGCTTGGGAATAGTACGA |
271 bp |
Multiplex PCR
Emerald Amp GT PCR master mix (Takara) (Code No. RR310) kit was used for multiplex PCR amplification on a total volume of 25 μL samples. The mixtures involved in the PCR reaction contained 12.5μL of PCR master mix (RR310A Kit), 1μL forward primer, 1μL reverse primers, 6μL of extracted DNA, and 4.5μL double distilled water. For the multiplex PCR, common forward primers for beef and mutton meat were accepted and utilized in combination with species-specific oligonucleotide primers. The amplification process involved 35 cycles of initial denaturation at 94 C, followed by 10 minutes of final extension at 72 C using a thermal cycler. Molecular size markers were specified on each gel. Agarose gel electrophoresis was used to evaluate the PCR results.
DNA amplification
Finally, the amplified products were separated on ethidium bromide agarose gel and then electrophorized. Gel photographic pictures by the gel documentation system were taken and analyzed using computer software. A 100 bp DNA ladder was used.
GC/ MS/MS for evaluation of mutton meat authentication
Fatty acids profile evaluation including SFA, MUSFA, PUSFA, omega 3, and omega 6 by using GC/MS/MS. Fat was dissolved in a mixture of GC grade solvents (methanol, acetone, n-hexane, chloroform, and sodium methoxide) Sigma- Aldrich, USA. Fatty acid was extracted and saponified, then methylated by adding a diazomethane solution to convert to methyl esters. Methyl esters of different samples were dissolved in aliquots and chloroform solution and then analyzed by GC. GC-MS/MS (Agilent 8890-7010B/2019) evaluate fatty acids from C8 to C22 (17).
Statistical analysis
Data are displayed as mean±SD. Statistical analysis was conducted using one-way ANOVA followed by Tukey's post hoc test for multiple group comparisons using SPSS for Windows (Version 21.0; SPSS Inc., Chicago, IL, USA).
Results
Evaluation of mutton meat authentication by using multiplex PCR
The results in the current study presented in Figure 2 revealed multiplex PCR product by agarose gel electrophoreses Cyt-b gene for mutton and beef meat, amplified at 274 bp for mutton and 271 bp for beef. Multiplex PCR detects all the authenticated samples at different concentrations for mutton and beef meat (Figure 1).
Figure 1: Agarose gel electrophoresis for multiplex PCR product of cyt -b gene of mutton meat authenticated with beef meat. All samples (from lane 16 to lane 19) gave a positive band at 274 bp for mutton and 271 bp for beef. Lane L: Molecular weight marker 100bp DNA ladder. Lane P: Positive control. Lane N: Negative control. Lane 16: Mutton authenticated with Beef 0.5%. Lane 17: Mutton authenticated with Beef 5%. Lane 18: Mutton authenticated with Beef 30%. Lane 19: Mutton authenticated with Beef 50%.
Evaluation of SFA in mutton, beef, and mutton plus beef meat samples
In the current study and as shown in table 2, the results of the SFA in the samples of mutton plus beef 50% compared to the samples of mutton meat showed a significant increase in the levels of palmitic acid (C16) and stearic acid (C18). Moreover, the levels of pentadecanoic acid (C15), margaric acid (C17), and nonadecanoic acid (C19) were significantly decreased. However, there were no significant changes in the levels of lauric acid (C12), myristic acid (C14), and arachidic acid (C20). Furthermore, when we compared the results of SFA of mutton plus beef with the beef meat, we found there was a significant elevation in the contents of (C15) and (C17) and a significant reduction in the contents of (C12), (C14), (C18), and (C19). There was no significant change in the levels of (C16) and (C20). The total SFA results showed a significant increase in the mutton plus beef 49.58% compared to the mutton meat 39.48% by a percentage of 25.58%.
Table 2: SFA in mutton, beef, and mutton plus beef meat samples by using GC/ MS/MS
Parameters |
Groups |
Significant |
||||||
Mutton |
Beef |
Mutton+Beef |
F |
P |
P post Hoc |
LSD |
||
Saturated Fatty Acids |
C12 |
0.10±0.01 |
0.14±0.01 |
0.07±.017 |
22.200 |
0.002* |
A: 0.021* B: 0.066 C: 0.001* |
0.02 |
C14 |
2.70±0.36 |
5.86±0.56 |
3.20±0.40 |
42.527 |
0.000* |
A: 0.000* B: 0.420 C: 0.001* |
0.62 |
|
C15 |
2.88±0.20 |
0.70±0.10 |
1.51±0.02 |
204.264 |
0.000* |
A: 0.000* B: 0.000* C: 0.001* |
0.18 |
|
C16 |
14.88±0.51 |
21.87±1.03 |
20.95±0.62 |
75.123 |
0.000* |
A: 0.000* B: 0.000* C: 0.362 |
1.03 |
|
C17 |
6.22±0.43 |
1.57±0.46 |
3.13±0.54 |
71.417 |
0.000* |
A: 0.000* B: 0.001* C: 0.018* |
0.66 |
|
C18 |
12.39±0.84 |
27.33±1.25 |
20.56±1.09 |
144.779 |
0.000* |
A: 0.000* B: 0.000* C: 0.001* |
0.70 |
|
C19 |
0.25±0.08 |
0.10±0.01 |
0.09±0.02 |
9.038 |
0.015* |
A: 0.028* B: 0.021* C: 0.970 |
0.08 |
|
C20 |
0.06±0.01 |
0.10±0.01 |
0.07±0.02 |
6.500 |
0.031* |
A: 0.031* B: 0.679 C: 0.090 |
0.02 |
|
TSFA |
39.48±1.87 |
57.91±1.89 |
49.58±0.92 |
96.586 |
0.000* |
A: 0.000* B: 0.001* C: 0.002* |
2.2 |
F one-way ANOVA, p: significant at level <0.05, P: post Hoc, A: Mutton - Beef, B: Mutton - Mutton+Beef, C: Beef - Mutton+Beef, In the case of Least Significant Differences (LSD), a significant result means at least one group differs from the other groups. (C12): lauric acid, (C14): myristic acid, (C15): pentadecanoic acid, (C16): palmitic acid, (C17): margaric acid, (C18): stearic acid, (C19): nonadecanoic acid, (C20): arachidic acid, TSFA: total saturated fatty acids.
Evaluation of MUSFA in mutton, beef, and mutton plus beef meat samples
The findings of MUSFA in the mutton plus beef meat were significantly reduced for palmitoleic acid (C16:1), 10-heptadecenoic acid (C17:1), and Cis-vaccenic acid (C18:1c6), Trans-vaccenic acid (C18:1n11t), 10-nonadecenoic acid (C19:1), and 11-eicosenoic acid (C20:1) compared to that of mutton meat. While the findings of elaidic acid (C18:1n9t) were significantly elevated in the samples of mutton plus beef meat compared to the samples of mutton meat. No significant changes occurred in the levels of myristoleic acid (C14:1) and oleic acid (C18:1n9) of the mutton plus beef meat compared to the beef meat (Table 3). The results of MUSFA of the samples of mutton plus beef showed a significant elevation of (C14:1) and (C17:1), a significant reduction of (C16:1), and no significant changes in (C18:1n9t), (C18:1c6), (C18:1n9), (C18:1n11t), C19:1), and 11-eicosenoic acid (C20:1) compared to the beef meat samples. The total MUSFA in the mutton-authenticated beef samples was 48.59 mg/100 g (Table 3). According to the previous results, the levels of the total MUSFA of the mutton plus beef samples were reduced by 16.98% compared to the mutton meat.
Table 3: MUSFA in mutton, beef, and mutton plus beef meat samples by using GC/ MS/MS
Parameters |
Groups |
Significant |
||||||
Mutton |
Beef |
Mutton+Beef |
F |
P |
P post Hoc |
LSD |
||
Mono-unsaturated Fatty Acids |
C14:1 |
0.12±0.02 |
0.80±0.10 |
0.22±0.02 |
111.114 |
0.000* |
A: 0.000* B: 0.155 C: 0.000* |
0.08 |
C16:1 |
0.47±0.01 |
0.23±0.05 |
0.14±0.02 |
80.113 |
0.000* |
A: 0.000* B: 0.000* C: 0.026* |
0.04 |
|
C17:1 |
3.85±0.32 |
0.38±0.08 |
1.59±0.17 |
193.881 |
0.000* |
A: 0.000* B: 0.000* C: 0.001* |
0.3 |
|
C18:1n9t |
0.00±0.00 |
3.58±0.55 |
2.48±0.55 |
47.335 |
0.000* |
A: 0.001* B: 0.000* C: 0.065 |
1.4 |
|
C18:1c6 |
15.13±1.14 |
1.19±1.56 |
1.95±0.43 |
139.650 |
0.000* |
A: 0.000* B: 0.000* C: 0.709 |
1.56 |
|
C18:1n9 |
35.88±0.96 |
35.37±1.05 |
39.34±3.76 |
2.589 |
0.155 |
A: 0.961 B: 0.241 C: 0.172 |
4.46 |
|
C18:1n11t |
2.56±0.25 |
0.80±0.10 |
1.06±0.06 |
106.432 |
0.000* |
A: 0.000* B: 0.000* C: 0.196 |
0.22 |
|
C19:1 |
0.29±0.02 |
0.05±0.01 |
0.08±0.01 |
171.000 |
0.000* |
A: 0.000* B: 0.000* C: 0.165 |
0.02 |
|
C20:1 |
0.15±0.01 |
0.07±0.01 |
0.08±0.01 |
57.000 |
0.000* |
A: 0.000* B: 0.000* C: 0.483 |
0.01 |
|
TMUSFA |
58.39±0.89 |
40.87±1.57 |
48.59±1.57 |
120.9 |
0.000* |
A: 0.000* B: 0.001* C: 0.001* |
2.15 |
F one-way ANOVA, p: significant at level <0.05, P: post Hoc, A: Mutton - Beef, B: Mutton - Mutton+Beef, C: Beef - Mutton+Beef, In the case of Least Significant Differences (LSD), a significant result means at least one group differs from the other groups. (C14:1): myristoleic acid, (C16:1): palmitoleic acid, (C17:1): 10-heptadecenoic acid, (C18:1n9t): elaidic acid, (C18:1c6): Cis-vaccenic acid, (C18:1n9): oleic acid, (C18:1n11t): Trans-vaccenic acid, (C19:1): 10-nonadecenoic acid, (C20:1): 11-eicosenoic acid, TMUSFA: total monounsaturated fatty acids.
Evaluation of PUSFA in mutton, beef, and mutton plus beef meat samples
As shown in table 4, the PUSFA results of the mutton plus beef samples exerted a significant elevation in the linolenic acid (C18:3), a significant reduction in the linoelaidic acid (C18:2n6t), and no significant changes in linoleic acid (C18:2n6), 7,10-octadecadienoic acid (C18:1), and 8,11-eicosadienoic acid (C20:3) levels compared to the mutton meat samples. Whereas, the comparison of the results of mutton authenticated beef meat with the beef meat showed a significant increase in (C18:2n6t), a significant decrease in (C20:3), and no significant change in (C18:2n6), (C18:3), and (C18:1) levels. The total PUSFA contents in the mutton, mutton plus beef, and beef meat samples were 2.09, 1.22, and 0.98 mg/100 g, respectively. From the previous findings, the total PUSFA of mutton plus beef was reduced by 53.11% compared to the mutton meat samples.
Table 4: PUSFA in mutton, beef, and mutton plus beef meat samples by using GC/ MS/MS
Parameters |
Groups |
Significant |
||||||
Mutton |
Beef |
Mutton + Beef |
F |
P |
P post Hoc |
LSD |
||
Poly-unsaturated Fatty Acids |
C18:2n6 |
1.09±0.41 |
1.01±0.01 |
0.46±0.35 |
3.591 |
0.094 |
A: 0.948 B: 0.107 C: 0.160 |
0.55 |
C18:2n6t |
0.80±0.10 |
0.00±0.00 |
0.28±0.02 |
142.615 |
0.000* |
A: 0.000* B: 0.000* C: 0.003* |
0.11 |
|
C18:3 |
0.00±0.00 |
0.05±0.01 |
0.03±0.01 |
28.500 |
0.001* |
A: 0.001* B: 0.010* C: 0.054 |
0.02 |
|
C18:1 |
0.10±0.02 |
0.10±0.01 |
0.08±0.01 |
0.67 |
0.54 |
A: 1.000 B: 0.001 C: 0.001 |
0.04 |
|
C20:3 |
0.00±0.00 |
0.05±0.01 |
0.00±0.00 |
75.000 |
0.000* |
A: 0.000* B: 1.000 C: 0.000* |
0.0001 |
|
TPUSFA |
2.09±0.78 |
1.22±.02 |
0.98±0.10 |
4.863 |
0.055 |
A: 0.129 B: 0.052 C: 0.762 |
0.76 |
F one-way ANOVA, p: significant at level <0.05, P: post Hoc, A: Mutton - Beef, B: Mutton - Mutton+Beef, C: Beef - Mutton+Beef, In the case of Least Significant Differences (LSD), a significant result means at least one group differs from the other groups. (C18:2n6): linoleic acid, (C18:2n6t): linoelaidic acid, (C18:3): linolenic acid, (C18:1): 7,10-octadecadienoic acid, (C20:3): 8,11-eicosadienoic acid, TPUSFA: total polyunsaturated fatty acids.
Total USFA content in mutton, beef, and mutton plus beef meat samples
The content of the total USFA in the mutton plus beef samples was significantly reduced compared to the mutton meat and significantly increased compared to the beef meat samples (Table 5).
Trans fatty acids content in mutton, beef, and mutton plus beef meat samples
In our work, the trans fatty acids content of the mutton plus beef samples was significantly increased compared to the mutton meat. It was significantly decreased compared to the beef meat samples (Table 5).
Evaluation of omega 3 and 6 content in mutton, beef, and mutton plus beef meat samples
The results of omega 3 and 6 are illustrated in table 5. There was a significant increase of Omega 3 in the mutton plus beef meat samples compared to the mutton samples. While there was no significant change in the omega 3 of mutton plus beef samples compared to the beef meat samples. Furthermore, the findings of omega 6 content showed no significant change between the specimens of mutton, beef, and mutton plus beef meat.
Table 5: Omega3, Omega 6, TUSFA, and TFA in mutton, beef, and mutton plus beef meat samples by using GC/ MS/MS
Parameters |
Groups |
Significant |
|||||
Mutton |
Beef |
Mutton+Beef |
F |
P |
P post Hoc |
LSD |
|
Omega 3 |
0.00±0.00 |
0.05±0.01 |
0.03±0.01 |
28.500 |
0.001* |
A: 0.001* B: 0.010* C: 0.054 |
0.02 |
Omega 6 |
1.09±0.95 |
1.01±0.01 |
0.64±0.06 |
0.563 |
0.597 |
A: 0.983 B: 0.607 C: 0.707 |
2.86 |
TUSFA |
60.48±0.62 |
42.09±1.59 |
49.57±1.15 |
180.9 |
0.000* |
A: 0.000* B: 0.001* C: 0.002* |
2.16 |
TFA |
3.40±0.60 |
3.69±0.41 |
6.37±0.82 |
20.042 |
0.002* |
A: 0.845 B: 0.003* C: 0.005* |
5.74 |
F one-way ANOVA, p: significant at level <0.05, P: post Hoc, A: Mutton - Beef, B: Mutton - Mutton+Beef, C: Beef - Mutton+Beef, In the case of Least Significant Differences (LSD), a significant result means at least one group differs from the other groups. TUSFA: total unsaturated fatty acids, TFA: trans fatty acids.
Discussion
Meat hygiene and forensic applications must consider the animal species in an unknown meat sample with the rising existence of illegal incidents such as meat fraud. One of the most popular meat products is mutton because of their nutritional properties, sensory attributes, physicochemical composition, and characteristic flavor compared to other meat species (18). As well as its healthier consideration (19). So, many higher educational consumers prefer mutton over other meat (20). The authenticity of mutton meat products to decrease the cost of production widely speeded in Egyptian markets and restaurants.
In this study, the mitochondrial gene cytochrome-b was used to detect mutton meat authenticity even if adulterated with a closely related gene, such as beef meat. Multiplex PCR detected even a small concentration of adulteration, even 0.5%. These results confirmed the viability of multiplex PCR for detecting meat fraud and agree with Dalmasso et al. (21), Hossain et al. (22), and Wang et al. (23). Galal-Khallaf also recommended DNA-based methods, such as multiplex PCR, for the detection of meat authentication due to its accuracy, fast, and sensitivity (24). Species-specific targeting mitochondrial (mt) genes have received significant attention (25,26).
Moreover, using cytochrome b as a mitochondrial gene is exceptionally conserved in different species of animals (27), because it produces a high copy number of small, circular mitochondrial DNA per cell and resists the processing temperature of food products (28). Many previous studies confirmed the efficiency of PCR sequencing of mitochondrial genes in accurately detecting meat authentication (fresh or processed meat products), including sheep, cattle, buffalo, chicken, and goats (13,29), as it is very powerful in differentiating between different genes (30). Moreover, it is a rapid, sensitive, and accurate method (31).
Concerning the fatty acids profile of mutton meat (tallow) by GC/MS/MS, results revealed that mutton meat containing mutton tallow (MT) is composed of SFA 39.48%. These results changed after mutton meat was experimentally authenticated by beef 50% to be 49.58% for total SFA, 50.42 for total USFAC, and 6.37 for Trans Fatty Acids. These results are lower than those reported by Liu et al. (32), who find that it is about 62% of saturated fatty acids in mutton tallow. The results differ regarding the age, breed, and nutrition of animals. The average percentage of myristic acid (C14) in mutton meat in the current study is in the same range as that reported by Banskalieva et al. (33), and USDA (34). Other fatty acids, palmitic acid (C16), stearic acid (C18), palmitoleic acid (C16.1), 7,10-octadecadienoic acid (C18.1), linoleic acid (C18.2), and linolenic acid (C18.3), of mutton meat in our experiment were slightly reduced than those in the previous studies. GC/MS recently proved accurate and sensitive for detecting meat and fat fraud (35,36). Recent studies were performed to examine the food safety of different types of meat (37-39). In Egyptian marketplaces, the addition of an undeclared meat species is previously reported by Zahran et al. (3), and Yacoub et al. (40) worldwide Jin et al. (41), and Li et al. (42).
Conclusions
Mutton meat authentication with beef is hardly detected by traditional ways of detection due to the genetic relationship between the two species. Multiplex PCR proved an accurate method for detecting mutton meat adulteration with beef, even at low concentrations. Moreover, GC/MS/MS provides an illustrated fatty acids profile for mutton that is affected if authenticated with other species. Multiplex PCR and GC/MS/MS have been established to be valued techniques for the forensic identification of species and detecting fraud and adulteration of mutton meat.
Conflict of interest
The authors of this article have no conflict of interest.