Abstract
This work aimed to focus on the antibacterial properties of garlic nanoemulsion on some multidrug resistance (MDR) strains of Pseudomonas aeruginosaisolated from broiler farms and hatcheries in Sharkia and Ismailia governorates, Egypt. Pseudomonas spp. was isolated in 21.3% of collected samples. It was isolated from younger broilers 1-10 days with an incidence rate of 22% (11/50), older broilers 16% (8/50), dead embryo in shell 31.4% (11/35), and from hatcheries was 13.3% (2/15). There was a variable range of antibiotic resistance ranging from 66.7-100% against the isolated strains of P. aeruginosa. Tetracycline and sulfamethoxazole-trimethoprim achieved the highest resistance rates, while penicillin and gentamycin were of a lower rate. However, norfloxacin, ciprofloxacin, and colistin were the most sensitive antibiotics against examined MDR P. aeruginosa.16SrDNA gene was found in ten P. aeruginosa isolates. Theseisolates were found to be virulent as oprL gene was detected in all isolates 100%. In addition, tetA(A),blaTEM,arr, and mexRantibiotic resistance genes were shown positive 100% in all MDR P. aeruginosa isolates. Minimum Inhibitory Concentration (MIC) values showed that garlic nanoemulsion (GN) was effective against examined P. aeruginosa at different concentrations. GN had 29.61% sulfur compounds of active components with 0.52 ug/ml of IC50 and 40.94 nm size with polydispersity index: 0.165 using dynamic light scattering had a 19.6± 5.11mV. In conclusion, the application of garlic nanoemulsion is an excellent alternative candidate to antibiotics for treatment because it significantly reduced the gene expression levels of MDR P. aeruginosa in broiler farms.
Main Subjects
Highlights
Full Text
Pseudomonas aeruginosa is an opportunistic pathogen that causes severe bacterial respiratory or septicemic problems in chicken farms (1).The mortality rate of newly hatched chicks was high in the later stages due to P. aeruginosa infection.(2).Various bacterial pathogens were isolated from dead embryos inside the eggs (3).The problem constantly begins when the incubated eggs have been contaminated with the organism from the surrounding environment (4). The multifactorial infection process of Pseudomonas is referred to their possession of several virulence determinants, including either cell-associated or extracellular factors such as lipopolysaccharide, alkaline protease, elastase, hemolysins, phospholipase "C" rhamnolipids, biofilm, Pilli, and flagella that induce its toxicity and pathogenicity (5,6). The mechanism of yolk sac infection with Pseudomonas spp.; it degrades yolk proteins causing infection since it is extensively colonized, producing more tissue damage than they could invade the blood, causing septicemia and significant mortalities in chickens (7). Biofilm formation, ability to induce chronic infections, the opportunistic nature of P. aeruginosa, and other factors is accounted for the high level of multiple drug resistance of this species (8). Recent studies confirmed multiple drugresistance P. aeruginosa against many antibiotics (9,10). Therefore, the WHO organization has recently proclaimed its extreme demand to develop new antibiotics to treat infections with MDR Pseudomonas spp (11). The evolution of multi-resistance problems against different classes of antibiotics and consequently the emergence of drug-resistant strains paid attention to nanomaterials (12). Nanomaterials are defined broadly as ecologically materials that have been utilized in numerous assortments of applications (12). Previous studies showed the mechanisms of a nanomaterial as antibacterial through different mechanisms. For example, bacterial cell division interacts, specifically, biofilm arrangement hindrance, enactment of both natural and versatile host immune response, the era of reactive oxygen species (ROS), and DNA or proteins interaction as intracellular induction effects (13). Furthermore, these materials can disturb the bacterial film acting on intracellular components, causing the malfunction of the cellular machinery (13). The high significant value of nanotechnology is stated due to the ability to manipulate, characterize, fabricate materials or devices, which have different dimensions (14). Nanoemulsions typically possess dimensions below 500 nm and have enhanced assimilation properties achieved through the mucosa (15). It demonstrates a high level of suspension stability and is produced through high-energy or low-energy methods due to their highly reduced dimensions (16).
Recent research is lacking specifically for garlic oil nano-emulsification and its relevant properties. For this reason, this study was aimed to create nano-emulsified garlic oil, investigate the antibacterial properties of some virulent MDR strains of P. aeruginosa in broilers and discuss their in-vitro genetic expression after treatment with Nano-garlic.
Material and methods
Ethical statement
The Animal Health Research Institute's (AHRI) Research Ethics Committee for Environmental and Clinical Studies approved the animal studies, which were carried out in accordance with the Egyptian Ethics Committee's guidelines and the National Institutes of Health's (NIH) Guidelines for the Care and Use of Laboratory Animals. The protocol number for these studies was 165590.
Sample collection
About 150 samples were aseptically collected from different broiler farms at Sharkia and Ismailia governorates, Egypt. Fifty samples of chicks (1-10 days old) and 50 cases of broilers in older ages. The represented samples for each case were included liver, heart, and lung samples. Moreover, 35 swabs from yolk sacs of late dead in shell embryo and 15 swabs from hatcheries were also collected. All samples were kept in the icebox and transported to the laboratory for bacterial isolation of Pseudomonas spp.
Table 1: Primers used for the amplification and Sequences of different genes in P. aeruginosa isolates
|
Target gene |
Function of target gene |
Primers sequences |
Size (bp) |
|
16S rDNA |
Conserved gene |
GACGGGTGAGTAATGCCTA |
618 |
|
CACTGGTGTTCCTTCCTATA |
|||
|
oprL |
Outer membrane lipoprotein virulence gene |
ATGGAAATGCTGAAATTCGGC |
504 |
|
CTTCTTCAGCTCGACGCGACG |
|||
|
blaTEM |
Beta lactamases resistance gene |
ATCAGCAATAAACCAGC |
516 |
|
CCCCGAAGAACGTTTTC |
|||
|
tetA(A) |
Tetracycline resistance gene |
GGTTCACTCGAACGACGTCA |
576 |
|
CTGTCCGACAAGTTGCATGA |
|||
|
arr |
Aminoglycoside response regulator gene |
AGCGCATCACCCCCAGCAAC |
686 |
|
CGCCAAGTGCGAGCCACTGA |
|||
|
mexR |
Multidrug resistance gene |
GCGCCATGGCCCATATTCAG |
637 |
|
GGCATTCGCCAGTAAGCGG |
Table 2: Cycling conditions used for the amplification of different genes in P. aeruginosa isolates
|
Target gene |
Size (bp) |
Denaturation ºC/min |
Amplification (35 cycles) ºC/sec |
Final extension ºC/min |
Reference |
||
|
Denaturation |
Annulation |
extension |
|||||
|
16S rDNA |
618 |
95/5 |
94/30 |
50/40 |
72/45 |
72/10 |
24 |
|
oprL |
504 |
95/5 |
55/40 |
25 |
|||
|
blaTEM |
516 |
95/5 |
54/40 |
26 |
|||
|
tetA(A) |
576 |
95/5 |
50/40 |
27 |
|||
|
arr |
686 |
94/5 |
55/40 |
28 |
|||
|
mexR |
637 |
94/5 |
55/40 |
29 |
|||
Preparation of nano garlic emulsion
The materials used in this study: Garlic oil; was purchased from oils extract a unit of National Research Center (NRC), Tween80; was obtained from Sigma-Aldrich Co. and deionized water. The garlic oil and tween 80 were mixed with a homogenous blender (1000 watts) for 5 min, then distilled water was added slowly to the mixed oil phase. The concentration of garlic oil micro-emulsion was 20% oil in water. Nano garlic emulsion was performed in Nanomaterials Research and synthesis unit using the method mentioned by (20).
Characterization of garlic oil nanoemulsion
Nanoemulsion was done using Fourier transmittance High-resolution transmission electron microscopy (HRTEM), then the results were observed via a JEM 1400F HRTEM at a beam energy of 300 keV. The components of garlic nanoemulsion using GC-MS at Nawah Scientific Inc. (Mokatam, Cairo, Egypt) and Zetasizer Malvern Instrument (Corp, Malvern, UK) measured the electrical conductivity, surface charge (zeta potential), droplet size, and size distribution (polydispersity indexes PDI) of the nanoemulsion material.
Cell culture
In this study, Vero (or green monkey) cell line was obtained from Nawah Scientific Inc. (Mokatam, Cairo, Egypt). The cells were maintained in DMEM media, supplemented with 100 mg/mL of streptomycin (100 units/mL) of penicillin and 10% of heat-inactivated fetal bovine serum in a humidified atmosphere with 5% CO2 (v/v) at 37ºC.
Cytotoxicity assay
The cell viability was assessed by SRB (sulforhodamine B) assay with different concentrations 0.01, 0.1, 1, 10 and 100 ug/ml (21).
Estimation of MIC of nano-garlic
Minimum Inhibitory Concentration (MIC) was estimated using 96 well-plates to detect the antibacterial effect of garlic nanoemulsion against ten P. aeruginosaisolates. First, 50 ul of peptone water broth was dispensed in each well of the column, then 50 ul of the garlic nanoemulsion was added in column “1”. Double serial dilutions were performed using a multichannel pipette for transferring and mixing garlic nanoemulsion from column 1-10. About 50 ul of P. aeruginosa broth (1.5 x105CFU /ml) was dispensed in each well of the column. Then they were incubated for 24 h at 37 °C. After incubation, 30 ul of 0.015% of resazurin was added and re-incubated for 2-4 h (for the observation of any color change). Columns with no change in color (blue resazurin color remained unchanged) were scored above the MIC value (22). Raw 1-10 served as ten P. aeruginosa isolates, column 1-10 two-fold serial diluted garlic nanoemulsion, column 11 negative control, and column 12 P. aeruginosa isolates positive control.
RNA extraction
first, before RNA purification from bacterial harvests, 0.5 ml of the fresh bacterial broth was mixed with 1 ml of RNA protect bacteria reagent (Qiagen, Germany, GmbH). To prevent bacterial RNA degradation, keeping the components for 5 min at room temperature; 200 μl of Tris EDTA buffer containing 1 mg/ml lysozyme (Thermo Fisher Scientific, GmbH, Germany) was added the pelleted bacteria. Bacterial RNA extraction was performed according to the QIAamp RNeasy Mini kit (Qiagen, Germany, GmbH). During RNA extraction, on-column DNase digestion was done to remove residual DNA.
SYBR green Rt-PCR
PCR reaction was applied in Stratagene MX3005P real-time PCR machine using specific primers as listed in Table (2). Specific primers were utilized in a one-step 25 μl reaction comprising 12.5 μl of the 2× QuantiTect SYBR Green PCR Master Mix (Qiagen, Germany, GmbH), 0.25 μl of RevertAid Reverse Transcriptase (200 U/μL) (Thermo Fisher Scientific, GmbH, Germany), 0.5 μl of different primer (20 pmol conc.), 8.25 μl of PCR grade water, and 3 μl of purified RNA.
Data analysis of the SYBR green rt-PCR
The relative expression of each resistant gene was normalized using the related bacterial housekeeping gene. Relative quantitation of gene expression on the RNA templates of the different samples was estimated using an untreated control sample to compare the CT value of each sample through the ΔΔCt method. The samples were tested in triplicates (24).
Results
Bacterial isolation, cultural characteristics and biochemical identification
According to morphological and cultural characteristics, the recovered isolates were of Pseudomonas spp. They exhibited a characteristic green, bluish color with Pseudomonas F-agar medium's fruity odor. They were non lactose fermenters on MacConkey agar medium. Biochemically, they gave positive reactions for oxidase, catalase, urea, citrate utilization, and gelatin hydrolysis tests, but indole, methyl red, and Voges Proskauer tests were adverse reactions. They ferment glucose, mannose, and xylose sugars. However, they were: sucrose, lactose, and maltose negative. On triple sugar iron (TSI)agar medium, P. aeruginosa produced red butt and slant without H2S production.
The overall prevalence ratio of Pseudomonas spp. in all examined samples in broiler of different ages and from hatcheries was 21.3% (32/150) (Table 3). A higher percentage of Pseudomonas spp. was detected in the young age of broiler chicks (1-10 days) (11/50) 22% than older ages of broilers (8/50) 16%. Moreover, it was recorded in 11 of 35 from late dead in shell embryo, but it was isolated in 2 of 15 samples from the hatcheries.
Table 3: Prevalence rate of the isolated Pseudomonas spp. in chickens
|
Type of sample |
Source |
No. |
No. of positive isolates |
% |
|
Dead in-shell chicken embryos |
Sharkia Ismailia |
20 15 |
11/35 |
31.4% |
|
Young chicks (1-10 days) |
Sharkia Ismailia |
25 25 |
11/50 |
22% |
|
Broilers (over ten days) |
Sharkia Ismailia |
35 15 |
8/50 |
16% |
|
Hatcheries |
Sharkia Ismailia |
10 5 |
2/15 |
13.3% |
|
Total |
-- |
150 |
32/150 |
21.3% |
Serological typing recovered in Pseudomonas spp. isolates confirmed that 32 isolates belonged to Pseudomonas spp. except only three isolates were serologically negative. The serologically identified isolates were 15 P. aeruginosa, nine P. fluorescens, P. putida (3 isolates), and P. fragi (2 isolates). In addition, according to the results of the slide agglutination test, the most prevalent P. aeruginosa serotypes were: O1, O3, O6, O10, and O11 (Table 4).
Table 4: Serogrouping of identified P. aeruginosa
|
Serotype |
Serogroup |
Identified isolates (n) |
|
P. aeruginosa O1 |
M |
3 |
|
P. aeruginosa O3 |
G |
2 |
|
P. aeruginosa O6 |
G |
5 |
|
P. aeruginosa O10 |
A |
1 |
|
P. aeruginosa O11 |
G |
4 |
|
Total |
15 |
|
Moreover, most of the 15 examined isolates of P. aeruginosa exhibited a multi-resistance drug phenomenon. They showed a variable range of resistance rate from 66.7%-100%. The isolates were 100% and 86.7% resistant to tetracycline and sulfamethoxazole-trimethoprim, respectively. However, a moderate rate of resistance was recorded against penicillin and gentamycin in 10 of 15 (66.7%). At the same time, streptomycin and doxycycline showed resistance in 11 of 15 (73.3%). However, ciprofloxacin, colistin, and norfloxacin were highly sensitive in 3/15 (20%), 2/15 (13.3%), and 4/15 (26.7%), respectively, as shown in Table 5.
Table 5: Phenotypic resistance profile of the examined P. aeruginosa strains
|
Chemotherapeutic group |
Chemotherapeutic Agents (dose) |
No. of resistant Strains (%) |
|
Aminoglycosides |
Streptomycin (10 µg) |
11/15 (73.3%) |
|
Gentamycin (10 µg) |
10/15 (66.7%) |
|
|
Tetracyclines |
Tetracycline (30 µg) |
15/15 (100%) |
|
Doxycycline (30 µg) |
11/15 (73.3%) |
|
|
β-Lactams |
Penicillin (10 μg) |
10/15 (66.7%) |
|
Polymyxins |
Colistin (10 µg) |
2/15 (13.3%) |
|
Fluoroquinolones
|
Norfloxacin (10 μg) |
4/15 (26.7%) |
|
Ciprofoxacine (5 μg) |
3/15 (20%) |
|
|
Diaminopyrimidine |
Sulfamethoxazole trimethoprim (25 μg) |
13/15 (86.7%) |
PCR investigation of genotypic virulence attributes of the recovered isolates
Ten examined P. aeruginosa isolates with multidrug resistance phenotypic attributes were randomly selected and tested by PCR (Tables 6 and 7). The results revealed that all 10/10 (100%) of the tested P. aeruginosa isolates were positive for (16srDNA and oprL) genes as demonstrated in (Figures 1 and 2).
Table 6: Resistance profiles of different virulence and resistant genes ofP. aeruginosa isolates
|
No. |
Source of isolates |
Serotype |
Resistant profile |
|
1 |
Young chicks (1-10 days) |
O1 |
S, T, P, CIP, CT, NOR, DO, CN, SXT |
|
2 |
Dead in-shell chicken embryos |
O3 |
S, T, P, CIP, CT, NOR DO, CN, SXT |
|
3 |
Broilers (over than ten days) |
O6 |
S, T, P, CIP, NOR, DO, CN, SXT |
|
4 |
Hatcheries |
O11 |
S, T, P, NOR, DO, CN, SXT |
|
5 |
Young chicks (1-10 days) |
O10 |
S, T, P, DO, CN, SXT |
|
6 |
Dead in-shell chicken embryos |
O1 |
S, T, P, DO, CN, SXT |
|
7 |
Broilers (over than ten days) |
O6 |
S, T, P, DO, CN, SXT |
|
8 |
Hatcheries |
O11 |
S, T, P, DO, CN, SXT |
|
9 |
Young chicks (1-10 days) |
O11 |
S, T, P, DO, CN, SXT |
|
10 |
Dead in-shell chicken embryos |
O6 |
S, T, P, DO, CN, SXT |
S: Streptomycin, T: Tetracycline, P: Penicillin, CIP: Ciprofloxacin, NOR: Norflaxacine, CT: Colistin, DO: Doxycycline, CN: Gentamycin, SXT: Sulfamethoxazole trimethoprim
Table 7: Genotypic characterization of different virulence and resistant genes ofP. aeruginosa isolates
|
Isolates no. |
Conserved gene |
Virulence genes |
Resistant genes |
|||
|
16srDNA |
oprL |
blaTEM |
arr |
mexR |
tetA(A) |
|
|
1 |
+ |
+ |
+ |
+ |
+ |
+ |
|
2 |
+ |
+ |
+ |
+ |
+ |
+ |
|
3 |
+ |
+ |
+ |
+ |
+ |
+ |
|
4 |
+ |
+ |
+ |
+ |
+ |
+ |
|
5 |
+ |
+ |
+ |
+ |
+ |
+ |
|
6 |
+ |
+ |
+ |
+ |
+ |
+ |
|
7 |
+ |
+ |
+ |
+ |
+ |
+ |
|
8 |
+ |
+ |
+ |
+ |
+ |
+ |
|
9 |
+ |
+ |
+ |
+ |
+ |
+ |
|
10 |
+ |
+ |
+ |
+ |
+ |
+ |
|
Total (%) |
10/10 (100%) |
10/10 (100%) |
10/10 (100%) |
10/10 (100%) |
10/10 (100%) |
10/10 (100%) |
Figure 1: 16srDNA gene results at 618bp for polymerase chain reaction products, lane 1-10 positive for, Lane (L): DNA molecular size marker, lane (P): positive control, lane (N): negative control.
Figure 2: oprL gene results at 504 bp for polymerase chain reaction products, lane 1-10 favorable, Lane (L): DNA molecular size marker, lane (P): positive control, lane (N): negative control.
Genotypic resistance of the recovered isolates by PCR
Ten examined MDR P. aeruginosa isolates were screened for tetracycline and beta-lactamases resistance genotypic attributes (tetA A and blaTEM), which were confirmed in 10/10 (100%) (Figures 3 and 4). Both aminoglycoside response regulator genes (arr) and multidrug resistance gene (mexR) also were detected in 100% of P. aeruginosa isolates (Figures 5 and 6). These genes were used to evaluate the garlic oil nanoemulsion effect.
Figure 3: tetA(A)generesults at 576bp for polymerase chain reaction products, lane 1-10 favorable, Lane (L): DNA molecular size marker, lane (P): positive control, lane (N): negative control.
Figure 4: blaTEM gene results at 516bp for polymerase chain reaction products, lane 1-10 positive, Lane (L): DNA molecular size marker, lane (P): positive control, lane (N): negative control.
Figure 5: arr gene results at 686 bp for polymerase chain reaction products, lane 1-10 positive, Lane (L): DNA molecular size marker, lane (P): positive control, lane (N): negative control.
Figure 6: mexR gene results at 637bp for polymerase chain reaction products, lane 1-10 positive, Lane (L): DNA molecular size marker, lane (P): positive control, lane (N): negative control.
Characterization of garlic nanoemulsion
Garlic oil nanoemulsion was mainly characterized by TEM non-emulsion size, 40.94 nm with a narrow size distribution (polydispersity index: 0.165), indicating greater homogeneity in nanodroplet size (Figure 7).The zeta potential indicates stable suspensions, generally taken by using dynamic light scattering (DLS), which had a 19.6± 5.11mV, same viscosity 0.08872 (cp), and conductivity 0.36±2.34 ms/cm.
When GC-Mass was analyzed the garlic nanoemulsion, many active components were found relative to sulfur compounds: Trisulfide, dipropyl 2.68%, Tetrasulfide, di-2-propenyl 1.44%, Diallyl disulfide 2.25%, Disulfide, dipropyl 1.28%, Trisulfide, methyl propyl 2.21%, Trisulfide, methyl 2-propenyl 4.37%, Trisulfide, di-2-propenyl 8.00%, Allyl-3-propyl tri sulfane 5.69% and Tetrasulfide dipropyl 1.39%. Other active compounds were also found such as isochiapin B 3.21%, Hexadecanoic acid 4.54%, vaccenic acid 13.41%, N-Methyl-N-benzyltetradecanamine 2.53%, 3-(Benzylmethylamino)-1-propanol 4.28%, 1-Dodecanamine, N, N-dimethyl- 2.32%, 4-dimethylaminoaniline 1.44%, Benzyl chloride 7.74% and Tetrangulol 2.21% as shown in (Figure 8).
On the confluent surface of Vero cells, the obtained results for garlic oil nanoemulsion with different concentrations 0.01, 0.1, 1, 10 and 100 ug/ml three days post inoculation showed that the cell viability% using SRB assay was 97.18, 86.22, 33.69, 6.20, and 0.18%, respectively and IC50= 0.52 ug/ml as shown in (Figure 9).
Figure 7: garlic nanoemulsion under HRTEM shown that nano-droplet size, 40.94 nm with a ng greater homogeneity.
Figure 8: Chemical compounds analysis of garlic nanoemulsion using GC-Mass.
Figure 9: Cell viability% of garlic nanoemulsion effect on Vero cells.
Determination of MIC for garlic nanoemulsionagainst the ten P. aeruginosa isolates
The antimicrobial activity and microdilution susceptibility test of garlic nanoemulsionwas determined using MIC value as the lowest concentration changed the color (positive result when color turned from purple to pink or colorlessness) against ten examined MDR P. aeruginosa isolates. The plates in a modified resazurin assay appeared after 24 hours (as pink color indicated growth, but blue color means inhibition of the growth). In this study, column (no.11) was considered as the negative control (stain and medium), and column (no.12) was thepositive one; (it means a change of resazurin natural color (blue/purple) to the reduced form (red-colorless). The effect of two-fold serial dilation of garlic nanoemulsion (MIC) on ten P. aeruginosa isolates revealed that the concentration 1:8 corresponds to the MIC values of isolates (no.1, 4, 5, 6, 7, and 8) and 1:4 corresponds to isolates (no.2 and 3), respectively. The concentration effect of isolates no.9 and 10 is 1:16 and 1:32, respectively. Garlic nanoemulsionrevealed significant effects and proved that garlic nanoemulsion could stop the growth of P. aeruginosa isolates.
Determination of resistant genes expression by real-time PCR
Genes expressions of mexR, arr, tetA(A), and blaTEM genes on the RNA level of five selected MDR P. aeruginosa were investigated. Resistant genes expression revealed relatively different degrees of resistant genes downregulation on microbial RNA by real-time PCR concerning the untreated str that ranged from (0.23 to 0.41) for blaTEM gene, (0.30 to 0.43) for tetA(A) gene, (0.19 to 0.33) for arr gene and (0.16 to 0.24) for mexR gene (Figure10).
Figure 10: Effect of garlic oil nanoemulsion on the resistance genes expression of P. aeruginosa isolates.
Discussion
Pseudomonas aeruginosa is a severe poultry pathogen and an acute hatchery-born disease due to environmental contamination, leading to a severe problem in the poultry industry. Its epidemics may spread rapidly through poultry flocks causing mortality of all ages (30). The prescriptive morphological and cultural characteristics of the isolated species in this study revealed Gram-negative bacilli microscopically with typical bluish-green color on Pseudomonas agar. At the same time, they were pale on MacConkey agar media, confirming that they were related to Pseudomonas spp. The same morphological and cultural features of Pseudomonas isolates were recorded by (31,4)
In this study, the total incidence ratio of Pseudomonas spp in broiler farms from chicken and hatcheries was 21.3% (32/150). Similarly, P. aeruginosa was yielded in broilers farms in 21, 17.6, 18.6, 19 and 20%, respectively (30-37). Isolates of the Pseudomonas species, including 23 (46%) for beef meat, 11 (22%) for mutton, and 19 (38%) for chicken meat, were obtained from all types of meat 35.33% which identified molecularly by detected of the 16S rRNA gene and rpoB gene (33).
In comparison, a higher percentage 52% was detected by Elsayed et al. (2), but a lower rate of P. aeruginosa (8%) was also recorded by Betty et al. (35) from the diseased chicken with respiratory symptoms. Moreover, 17/372 isolates of P. aeruginosa 4.57% from apparently healthy, diseased, and freshly dead chickens were obtained (36). Variations in isolation percentages might be referred to by many factors, including the type of the examined samples, immune status of the bird, degree of contamination, type, and virulence of the strain (37).
On the other hand, recent studies stated that P. aeruginosa was detected in young chickens with high mortalities and late embryos dead inside eggs (38). In this study, a strong correlation between age and the incidence of P. aeruginosa in broilerswas observed. A higher isolation rate was detected in age 1-10 days at a rate of 22% (11/50) than older ages of broilers 16% (8/50).
Moreover, the present study shows that P. aeruginosa yielded 31.4% (11/35) of late dead in shell embryo and the hatcheries in the percentage of 13.3% (2/15). In the same way, P. aeruginosa was found in 19% of unhatched eggs (30). In addition, Balasubramanian et al. (43) detected P. aeruginosa organisms in 20% of a total of 200 samples of chicks (4 days old age). Results stated that P. aeruginosa was recordedin 20% in dead embryos and in19% in broiler chicks (1-10 days) (4). A high incidence of P. aeruginosa in dead embryos high mortalities in unhatched chicken and young chicks may occur due to environmental contamination during the hatching time, invasion of eggshell, or insufficient sanitization of hatcheries and incubators since P. aeruginosa were ordinarily found in soil, water, and muggy environments causing hatchery borne diseases in chicken farms (3).
Serological identification of Pseudomonas spp is exceptionally imperative since it encourages telling us about the predominant serotypes and finding sources of infection (39). In the current study, the most prevalent species was P. aeruginosa (15/32), which were serotyped as O1, O2, O6, O10, and O11. The previous data of P. aeruginosa serotyping were achieved with Nashwa et al. (40), that the serogrouping of these isolates indicated that the isolates were of A, G, and M serogroups. This result was accomplished with previous studies that illuminated that A, B, D, F, H, K, L, and M were the most predominant serotypes (41).
Multidrug-resistant bacteria are a nowadays authentic hazard in human and veterinary medicine (42). Many researchers studied the susceptibility of P. aeruginosa to various antimicrobials, which make it a very hard pathogen to eliminate, and they attributed that the P. aeruginosa genome possesses the most prominent known resistance island genes (43).
Moreover, most of the examined isolates of P. aeruginosa exhibited a multi-resistance drug phenomenon. In vitro, variable resistance rates 60-100% were recorded in this study. The isolates were 100% and 86.7% resistant to tetracycline and sulfamethoxazole-trimethoprim, respectively. However, a moderate rate of resistance of P. aeruginosa isolates was recorded against penicillin and streptomycin: 66.7% (10/15) and 73.3% (11/15), respectively. Meanwhile, they were susceptible to ciprofloxacin 3/15 (20%), colistin 2/15 (13.3%), and norfloxacin 4/15 (26.7%). These results were nearly agreed with Ashraf et al. (36), who reported that all P. aeruginosa isolates were resistant to tetracycline 88.2%, streptomycin 82.4%, penicillin (76.5%), doxycycline 75.2%, and gentamicin 73.3%, also our results go hand to hand with Shahat et al. (4) who obtained high sensitivity of all P. aeruginosa isolates with ciprofloxacin and norfloxacin. On the contrary, a lower sensitivity against ciprofloxacin and norfloxacin was illustrated (44).
Variation of our results with previous studies could be referred to the distinction in numerous conditions encompassing incubators or as a result of frequently occurring hyper-mutation among P. aeruginosa strains developing various antimicrobial resistance (45). Moreover, antibiotic-resistant bacteria (ARB) can quickly spread alongside the food chain and cause most public health hazards (46, 47).
In the current study, which agreed with Shahat et al. (4) that 16S rDNA gene found in P. aeruginosa with a prevalence rate of 100%. P. aeruginosa is various extracellular virulence factors and cellular components which are implicated in the pathogenesis of this pathogen (48), bacteria could acquire virulence factors from the surrounding environment resulting in cellular damages (49). oprL gene is essential for the integrity of P. aeruginosa and effluxes transport systems, which affects cell membrane permeability, giving its fundamental reason for antimicrobial resistance in this species (50). This study found the oprL gene 100% in all P. aeruginosa isolates. The same result was obtained from chicken embryos and broilers isolates (4, 25, 50).
PCR technique is also applied for studying the antimicrobial genotypic attributes of bacterial isolates by detecting resistant genes. In the current study, PCR confirmed 100% presence of tetA (A) and blaTEM (for tetracycline and beta-lactamases) antibiotic resistance genes in all ten examined P. aeruginosa strains, the same results obtained by (51,52) blaTEM gene 100% and tetA (A) 75.6%, respectively from tested P. aeruginosa isolates. In addition, the Aminoglycoside response regulator (arr) gene, a biofilm encoding gene, was detected in all P. aeruginosa isolates 100%. A similar result in which arr gene was recorded in all P. aeruginosa isolates of wild birds (53). Moreover, all the tested P. aeruginosa isolates showed to be positive for multidrug-resistant mexR gene10/10 (100%). These results agree with the results obtained by El-Deer dash et al. (54), who detected mexR gene 95% from P. aeruginosa isolates.
The fabrication of nanoemulsions with smaller droplet sizes is due to the presence of double bonds in the nonpolar chain of non-ionic surfactants were consistent with the conductivity of the nanoemulsions was increased as the essential oil concentration increased. That result demonstrated that water was during the continuous phase due to the solution conductivity being directly proportional to the number of ions, increasing as the ions increase (55).
Previous studies had found that a high concentration of sulfur compounds of garlic is an essential oil (GC analysis) such as diallyl trisulfide and diallyl disulfide possess good antimicrobial activity (56,57). In agreement with our study, the positive zeta potentials were significantly associated with nano-delivery system uptake across the mucosa (58). Furthermore, garlic oil nanoemulsions of mean size 36.3 nm, of average zeta potential was -26.23 mV (with different ratio of surfactant) was reported, and polydispersity index was 0.527 showed a weak antibacterial effect on some Gram-negative bacteria (59). Our study showed that garlic oil nanoemulsion's low MIC value revealed an antibacterial effect (partial bioactivity) against ten P. aeruginosa isolates. The active bacterial cells reduce the non-fluorescent resazurin (blue) to the fluorescent resorufin (pink), which can be further reduced to hydroresorufin, giving a direct, quantifiable measure of bacterial metabolic activity, and the MIC determined through recording of the color change was observed (60). Aeromonas spp. isolates were completely inhibited from growing by the use of chitosan nanoparticle alone or the coating of thyme oil with chitosan nanoparticle at a ratio of 1:1 and 1:0.75 g/ml which can be used as a decontaminant for water tanks and drinkers at the level of poultry farms as well as a disinfectant product and/or antimicrobial agent for the treatment of a drinking water distribution system (61).
The MIC method was used to assess the sensitivity of Pseudomonas aeruginosa to the antibiotics and the nanoparticles (CoFe2O4 and NiFe2O4) in vitro which had minimum inhibitor concentrations of 32 g/ml and 16 g/ml, respectively. The appearance/disappearance of bands, an increase in the thickness and clarity of the bands, and other effects of nanoparticles on P. aeruginosa's genetic material were noted in the results of the Random Amplification of Polymorphic DNA test. (62).
To evaluate the antimicrobial effect of garlic oil nanoemulsion, different resistant genes of P. aeruginosa isolates, including mexR, arr, tetA(A), and blaTEM, were examined by real-time quantitation PCR relatively, as high degree of bacterial resistant genes downregulation. Results of Real-time PCR agreed highly with phenotypic characterization as the highest degree for downregulation was encountered for all isolates. The results have confirmed the susceptibility of the different isolates to garlic oil nanoemulsion and supported the results obtained by the disk diffusion method. However, different degrees of resistant genes downregulation were recorded because it may be related to microbial response differences and variation in resistant gene expression. Our results revealed that gene expression levels of isolates were affected by garlic oil nanoemulsion. The superior RNA expression level in garlic nanoemulsion treated isolated was significantly different from non-treated or negative isolate control. Many studies recommended garlic oil nanoemulsion as an alternative for antibacterial medicines (63). Furthermore, Relative quantitation real-time PCR results were in remarkable concordance with results obtained by MIC and microdilution susceptibility test for P. aeruginosa isolates
Conclusion
This study showed that a high recovery rate of P. aeruginosa at different ages of chickens, especially in dead embryos inside eggshell assessed, is regarded as one of the most critical challenges in the poultry industry. A strict antibiotic policy and the implementation of infection control programs will aid in the reduction of MDR P. aeruginosa strains since the broadly used antibiotics usually evolve bacterial resistance or cause harmful influence on the birds’ vital organs in expansion to the possible buildups that remain in the poultry meat. Garlic oil nanoemulsion is a novel technology; recently been considered the best alternative to antibiotics in poultry farms. So, the possible use and diverse strategies of garlic nanoemulsion oil extraction for control of Pseudomonas spp. The bacterial infection should be held before and after using such application on the farm level. Moreover, In-vitro, garlic oil nanoemulsion could significantly reduce the gene expression levels of MDR P. aeruginosa.
Acknowledgments
We would like to thank Prof. Dr. Momtaz A Shahein, Animal Health Research Institute, Agricultural Research Center, Giza, Egypt for facilities of the research study.
Conflict of interest
The authors have no conflict of interest to declare.