Abstract
This study identified the etiological pathogens responsible or protozoal-like disease conditions in female camels from Al-Diwaniyah Province, Iraq. For this reason, 125 female camels (one blood sample per animal) that showed signs of weakness and pale mucus membranes were considered for the study. The samples of stained blood smears were explored microscopically and via a polymerase chain reaction (PCR) method that the targeted glutamine-dependent carbamoyl phosphate synthase (CPSII) gene for identifying Babesia bovis and 18S rRNA gene for detecting B. bigemina. The results of the microscopic technique uncovered the occurrence of Babesia spp. in 76 (60.8%) of the examined samples, which encourage the use of PCR to identify the protozoal species. The PCR findings demonstrated that B. bovis and B. bigemina were detected in 8 (8.9%) and 11 (12.22%), respectively, of the positive microscopic samples. The study findings reveal that weakness and paleness of mucus membranes in camel females can be attributed to the presence of infections by blood protozoa, mainly Babesia bovis and Babesia bigemina.
Main Subjects
Highlights
Full Text
Introduction
Babesiosis is a protozoan parasite carried by vectors that affect the veterinary and medical fields (1). Some hard ticks belonging to the Hyaloma, Rhipicephalus, and Dermacentor families deliver apicomplexan intraerythrocytic protozoa of the genus Babesia to a wide range of wild and domestic vertebrate animals, especially to domestic animals such as cows, sheep, goats, dogs, mice, rats, cats and birds, as well as humans, Babesiosis pathogenic agents are different species of the genus Babesia. Hemolytic anemia is a common consequence of babesiosis, which has been linked to many Babesial species, particularly B. bovis and B. bigemina (2). Apicomplexan shapes inside an erythrocyte appear as rings, ovals, maltan crosses, pears, and amoeboid forms with a length of 1-2.5 or 2.5-5 µl (3). For animals, the usual approach to diagnosing babesiosis depends on microscopic parasites methods in Giemsa-staining of venous blood samples and evaluation of clinical symptoms throughout the acute stage of the illness (4). Subclinical babesiosis infections are seen in babesiosis-infected animals throughout their life duration. In rare cases, microscopic examinations fail to find any parasites, resulting in false-negative results (5). This disease is difficult to diagnose based on appearance alone since many parasitic organisms may infect animals. As a result, molecular screening procedures can provide advantages for more precise identification of Babesia species and distinction from Theilera parasites in a time and cost-effective approach, particularly in parasitemia (6).
This study identified the etiological pathogens responsible or protozoal-like disease conditions in camel females from Al-Diwaniyah Province, Iraq.
Materials and methods
Blood samples
In the present study that was carried out from September, 2017 until the end of March, 2018, 125 female camels (Camelus dromedaries) were brought to a slaughterhouse in Al-Diwaniyah province, Iraq, and showed signs of weakness and pale mucus membranes with other asymptomatic camels were included in the present study. One blood sample per animal was collected from the jugular vein at 5 ml per female. Clean and sterile EDTA-blood-collecting tubes were used and immediately icebox-transported to the Laboratory of Parasitology, the College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah City, Iraq.
Microscopic examination
Thin blood smears stained with Giemsa stain on slides were employed to identify the presence of protozoa based on morphological characteristics as described by Soulsby (7). Briefly, a blood drop was placed on a slide and was spread out on this slide by another slide to make a thin smear. Then, the smear was left on a bench to dry and then to be absolute-methanol-fixed for 5mins, followed by staining with Giemsa stain for 30mins. Later, the slide was water-washed and left to dry. Finally, the slides were examined under a light microscope using an oil immersion lens (7).
Extraction of Babesia genomic DNA
The extraction of the Babesia genomic DNA was performed using the Column-pure blood Genomic DNA Mini Kit (Applied Biological Materials (Abm, Canada). The extraction procedures were performed per the kit protocol. The DNA was read to understand its purity and concentration using a NanoDrop.
PCR reaction
The primers used in the present study that targeted the CPSII gene for the detection of B. bovis and the 18S rRNA gene for the detection of B. bigemina are listed in table 1 (8-10), table 2 (11), table 3 (12) and table 4.
Table 1: Primers used in this study
Gene and Babesia species |
Sequence (5'-3') |
Product size (bp) |
Reference |
|
Babesia bovis CPSII |
F |
TTTGGTATTTGTCTTGGTCAT |
446-453 |
(8) |
R |
ACCACTGTAGTCAAACTCACC |
|||
Babesia bigemina 18ribosomal RNA gene |
F |
TAGTTGTATTTCAGCCTCGCG |
689 |
(9) |
R |
AACATCCAAGCAGCTAHTTAG |
|||
R |
TTGCCTTAAACTTCCTTG |
Table 2: The components of monoplex PCR
PCR components |
Volume (μl), 25 µl of total |
Master mix (2x) |
12.5 |
F Primer |
1.25 |
R Primer |
1.25 |
DNA |
5 |
PCR grade water |
5 |
Table 3: The components of multiplex PCR
PCR components |
Volume (μl), 25 µl of total |
Master mix (2x) |
12.5 |
F Primer (1) |
0.75 |
R Primer (1) |
0.75 |
Forward Primer (2) |
0.75 |
Reverse Primer (2) |
0.75 |
DNA template |
5 |
PCR grade water |
4.5 |
Table 4: PCR amplification program
Babesia species |
Initial Denaturation |
Cycle repeats= 40 |
Final extension |
||
Denaturation |
Annealing |
Extension |
|||
Babesia bovis |
94°C/280s |
94°C/120s |
59/60s |
72°C/60s |
72°C/60s |
Babesia bigemina |
94°C/280s |
94°C/120s |
58/60s |
72°C/60s |
72°C/60s |
Agarose gel at 1.5% stained with ethidium bromide was used in electrophoresis. The gel, then, was illuminated under a UV- imager.
Results
The results of the microscopic technique revealed the occurrence of Babesia spp. in 76 (60.8%) of the examined stained blood samples (Figure 1), which encourage the use of the PCR to identify the protozoal species.
Figure 1: Microscopic image of a blood sample stained with Giemsa stain from a female camel that shows the presence of Babesia spp inside an erythrocyte. 100x
The PCR findings demonstrated that B. bovis (Figure 2) and B. bigemina (Figure 3) were detected in 8 (8.9%) and 11 (12.22%), respectively, of the positive microscopic samples.
Figure 2: Image of 1.5% agarose gel electrophoresis of blood samples from positive camels that show the presence of Babesia bovis. M: PCR ladder (100-3000 bp) and lines; 1 to 5: Some positive blood specimens for Babesia bovis at 446bp for the glutamine-dependent carbamoyl phosphate synthase (CPSII) gene.
Figure 3: Image of 1.5% agarose gel electrophoresis of blood samples from positive camels that show the presence of Babesia bigemina. M: PCR ladder (100-1000bp) and lines; 1 to 9: Some positive blood specimens for Babesia bigemina at 689bp for the 18S rRNA gene.
Discussion
Tick-borne intraerythrocytic parasites, such as Babesia species, may cause severe or deadly infections in vertebrates in the late spring and early summer. Babesia parasites are not often seen in camels (12). Therefore, Babesia infections in camels have been understudied. The current study's clinical findings agree with Swelum et al. (13), who detected some clinical findings in camels infected with babesiosis, such as anemia, hemoglobinuria, and jaundice.
The current study's microscopic examination detected the presence of Babesia spp. in the blood samples of female camels in a high percentage. Mirahmadi et al. (3) detected, using Giemsa staining in a microscopy examination that only 10% of their 140 tested camels appeared to be infected with Babesia spp. in Iran. In addition, Ibrahim et al. (14) reported the occurrence of the protozoa in 43.6% of their tested camels in Sudan. Many studies have been done on babesiosis in various vertebrate animals. However, there have been few studies on Babesia infections in camels from different countries. Babesia was found in 3.54% of camels in a microscopy investigation in Zabol, Iran (15). Eight out of 122 camels tested positive for Babesia infections in another study conducted in Ahvaz, Iran; however, the species of the infected camels was not determined (16-18).
When it comes to diagnosing Babesia, El-Naga and Barghash (8) tested the two approaches and found that PCR had a higher detection rate (18.43%) than Giemsa staining (11.8%). Mirahmadi et al. (3) showed that all babesiosis infections were caused by B. caballi, which varies from the results of Ibrahim et al. (14), who found just one incident of B. caballi infection out of 200 afflicted camels. According to a study published in 2015 by Jasim et al. (19-21), the percentage of B. caballi infection in camels detected by two particular primers was 39.47%, and camels should be regarded as a source of the infection transmission to horses. Also, the spread of B. caballi by ticks in camels in Jordan has been documented by Qablan et al. (22). This importance of infection in camels encourages the investigation of protozoal infections in camels.
Conclusion
The current study findings reveal that weakness and paleness of mucus membranes in camel females can be attributed to the presence of infections by blood protozoa, mainly Babesia bovis and Babesia bigemina.
Acknowledgments
The authors thank Professor Jabbar Ahmed Alssady, Dean of College of Veterinary Medicine, University of Al-Qadisiyah, Iraq, for technical assistance.
Conflict of interests
The authors have not received any funding or benefits from industry, agency of financing, or elsewhere to conduct this study.