Abstract
In a drinking water distribution system, biofilm-producing bacteria are considered an alarm bell for increased emergence of waterborne pathogens. This study aims to monitor the prevalence of biofilm-forming Aeromonas species in the drinking water distribution systems in different broiler chicken farms. The antimicrobial activity of thyme essential oil (TEO), thyme essential oil nano-emulsion (TEO-N), chitosan (CS), chitosan nanoparticles (CS-NPs), and both CS and CS-NP-based coating TEO against the different Aeromonas spp.was evaluated using the broth microdilution and agar well diffusion assay. The overall prevalence rate of Aeromonas spp. was 49.3% (74.0/150). The highest rate of Aeromonas isolates was noted in water drinkers and tanks 75.0% (30/40) and 62.5% (25/40), respectively) followed by feedstuff 40.0% (12/30). In contrast, the highest percentage of biofilm-producing Aeromonas spp. was Aeromonas hydrophila 70.0% (14/20) followed by Aeromonas caviae 30.0% (6/20). The fatal effect of CS-NPs against all isolated Aeromonas spp. was achieved 100% at 1.5 and 2.0 µg/mL. Moreover, chitosan nanoparticles coating thyme essential oil (CS-NPs/TEO) verified the lethal effect 100% on both A. hydrophila and A. caviae at the ratio of 1:1 and 1:0.75 µg/mL. In conclusion, the main source of Aeromonas spp. in the drinking water distribution system was the unhygienic status of water tanks and drinkers that allowed biofilm to produce due to aggregation of Aeromonas bacteria on the inner surface of that equipment. Both CS-NPs and CS-NPs/TEO could be applied as a sanitizer and/or disinfectant for Aeromonas biofilm control.
Keywords
Main Subjects
Highlights
Article highlights
1. The lethal effect of CS-NPs against all isolated Aeromonas spp. was achieved 100% at 1.5 and 2.0µg/mL.
2. The CS-NPs/TEO proved quite effective in inhibiting growth of all Aeromonas spp. at 1:0.75µg/mL.
3. The CS-NPs/TEO can be applied as a disinfectant product for the treatment of a drinking water system.
4. The MIC for all Aeromonas spp. was CS>CS-NPs>TEO>TEO-N 1.25, 1.0, 0.25, and 0.15 μg/mL, respectively.
5. The MIC value of CS-TEO was barely higher 1:0.25 μg/mL than that of CS-NPs/TEO 1:0.15 μg/mL.
Full Text
Control of biofilm-producing Aeromonas bacteria in the water tanks and drinkers of broiler poultry farms using chitosan nanoparticle-based coating thyme oil
Asmaa N. Mohammed1 and Amira S. Attia2
1Department of Hygiene, Zoonoses and Epidemiology, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, Egypt
2Department of Veterinary Public Health, Faculty of Veterinary Medicine, Zagazig University, Zagazig, Egypt
asmaa.mohamed2@vet.bsu.edu.eg, https://orcid.org/0000-0002-7021-5520
amy_talat20002@yahoo.com, https://orcid.org/0000-0002-0100-982x
Abstract
In a drinking water distribution system, biofilm-producing bacteria are considered an alarm bell for increased emergence of waterborne pathogens. This study aims to monitor the prevalence of biofilm-forming Aeromonas species in the drinking water distribution systems in different broiler chicken farms. The antimicrobial activity of thyme essential oil (TEO), thyme essential oil nano-emulsion (TEO-N), chitosan (CS), chitosan nanoparticles (CS-NPs), and both CS and CS-NP-based coating TEO against the different Aeromonas spp.was evaluated using the broth microdilution and agar well diffusion assay. The overall prevalence rate of Aeromonas spp. was 49.3% (74.0/150). The highest rate of Aeromonas isolates was noted in water drinkers and tanks 75.0% (30/40) and 62.5% (25/40), respectively) followed by feedstuff 40.0% (12/30). In contrast, the highest percentage of biofilm-producing Aeromonas spp. was Aeromonas hydrophila 70.0% (14/20) followed by Aeromonas caviae 30.0% (6/20). The fatal effect of CS-NPs against all isolated Aeromonas spp. was achieved 100% at 1.5 and 2.0 µg/mL. Moreover, chitosan nanoparticles coating thyme essential oil (CS-NPs/TEO) verified the lethal effect 100% on both A. hydrophila and A. caviae at the ratio of 1:1 and 1:0.75 µg/mL. In conclusion, the main source of Aeromonas spp. in the drinking water distribution system was the unhygienic status of water tanks and drinkers that allowed biofilm to produce due to aggregation of Aeromonas bacteria on the inner surface of that equipment. Both CS-NPs and CS-NPs/TEO could be applied as a sanitizer and/or disinfectant for Aeromonas biofilm control.
Keywords:Biofilm, Aeromonas spp., Drinking water, CS-NPs/TEO
السیطرة على بکتیریا الأیروموناس المنتجة للبیوفیلم فی خزانات المیاه والمساقی لمزارع الدجاج اللاحم باستخدام زیت الزعتر المحمل على جزیئات الکیتوزان النانو
أسماء نادى محمد1 و أمیرة سمیرعطیة2
1قسم الصحة والأمراض المشترکة والوبائیات - کلیة الطب البیطری - جامعة بنی سویف – 62511 مصر.
2قسم الصحة العامة البیطریة - کلیة الطب البیطری - جامعة بالزقازیق- مصر.
الخلاصة
تعد البکتیریا المنتجة للغشاء الحیوی (البیوفیلم) فی نظام توزیع میاه الشرب بمثابة جرس إنذار لزیادة ظهور مسببات الأمراض المنقولة بالمیاه. لذا تهدف الدراسة إلى رصد مدى انتشار أنواع الأیروموناس المکونة للغشاء الحیوی فی أنظمة توزیع میاه الشرب فی مزارع الدجاج اللاحم المختلفة. کما تم تقییم النشاط المضاد للمیکروبات لکل من زیت الزعتر العطری، مستحلب النانو من زیت الزعتر، الکیتوزان، جزیئات الکیتوزان النانویة، زیت الزعتر المحمل على کلا من الکیتوزان وجزیئات الکیتوزان النانویة ضد جمیع أنواع معزولات الأیروموناس باستخدام التخفیف الکلی فی المرق ومقایسة انتشاره فى الأجار. وأظهرت التنائج أن معدل الانتشار لمیکروب الأیروموناس هو 49.3٪ (74/150). کما لوحظ أن أعلى معدل لمعزولات الأیروموناس فی خزانات ومساقی المیاه 75% (30/40) و 62.5% (25/40) على التوالی تلیها الأعلاف 40% (12/30). وفی المقابل، فإن أعلى نسبة مئویة من الأیروموناس المنتجة للغشاء الحیوی کانت الأیروموناس هیدروفیلا 70% (14/20) تلیها الأیروموناس کافی 30% (6/20). ووجد أن التأثیر الممیت لـ جزیئات الکیتوزان النانویة 100% ضد جمیع أنواع الأیروموناس المعزولة عند 1.5 و 2.0 میکروغرام / مل. علاوة على ذلک، أثبتت جزیئات الکیتوزان النانویة التی تغطی زیت الزعتر العطری تأثیرها الممیت 100% على کل من الأیروموناس هیدروفیلا وکافی بنسبة 1: 1 و 1: 0.75 میکروغرام / مل. ولقد أثبتت الدراسة أن المصدر الرئیسی لـمیکروب الأیروموناس فی نظام توزیع میاه الشرب هى الحالة غیر الصحیة لخزانات المیاه والمساقی التی سمحت للأغشیة الحیویة بالإنتاج بسبب تراکم بکتیریا الأیروموناس على السطح الداخلی لتلک المعدات. کما یمکن استخدام کل من جزیئات الکیتوزان النانویة وزیت الزعتر العطری المحمل على جزیئات الکیتوزان النانویة کمطهر للسیطرة على الغشاء الحیوی المنتج بمیکروب الأیروموناس.
Introduction
The existence of biofilms forming bacterial organisms in drinking water systems has received inadequate consideration (1). In addition, the assessment of biofilm microbial isolates of drinking water distribution systems remains ambiguous, and there is negligible literature demonstrating that certain bacteria are integral parts of biofilm in the distribution systems of water (2). The occurrence of biofilm in a drinking water system could enhance the provision of nutrients and carbon required for bacterial biosynthesis. This could permit the persistence and propagation of diverse pathogenic bacteria, such as Aeromonas hydrophila and Pseudomonas aeruginosa,and other fungi, viruses, and protozoa (3). These organisms are related to a variety of infections and symptoms, such as diarrhea, gastroenteritis, food poisoning, typhoid fever, chronic sinusitis, chronic wound infection, endocarditis, osteonecrosis, and severe periodontal diseases (4) besides tothe microorganism has been isolated from several environmentalsuch as aquatic one (5). According to the United States Environmental Protection Agency (6) Aeromonas bacteriaare listed as emerging waterborne pathogens that can grow in chlorinated water distribution systems and form biofilm. Furthermore, A. hydrophila has been identified as a contributing agent to intestinal and extraintestinal diseases in humans, including septic arthritis, fulminating septicemia, diarrhea, gastroenteritis, wound infections, and meningitis. The pathogenicity of Aeromonas has been associated with several known virulence factors, such as aerolysin, hemolysin, proteases, lipases, and DNases (7). These toxins play a foremost role in disease progression (8). Nowadays, the investigation of new antimicrobial agents to control different infections in animals and on poultry farms has become an urgent need. Therefore, the application of natural material and/or some essential oils (EOs) against a wide variety of microorganisms is quite imperative (9). There is literature verifying that EOs containing a high content of phenolic derivatives (such as thyme and carvacrol) target the bacterial membrane transport system, causing disrupting at the cytoplasmic homeostasis, affecting the microbial enzyme system (10). Additionally, the hazardous growth of microbial resistance has increased hope that replacing antibiotics with EOs could potentially become a safe way to use natural growth promoters for farmed animals in their diets to improve the quality of gut microbiota. Thus, results could show good growth performance of animals and eventually contribute to consumer safety (11). Chitosan (CS) is a natural cationic polysaccharide obtained from crustacean shells such as crabs and shrimp using either chemical or microbiological procedures (12). It has unique biological characteristics, being both biodegradable and non-toxic (13). Many applications have been found, either alone or in combination with other natural polymers in food, textiles, water treatment, and other industries. CS has proved its activity against foodborne pathogens, pathogenic viruses, and fungi (14). CS has also proven its ability to load sensitive bioactive composites or compounds such as lipophilic drugs and polyphenolic compounds (15). However, to the best of our knowledge, the creation of novel composites (chitosan nanoparticle-based coating with thyme essential oil (CS-NPs/TEO) using CS particles at a nanoscale range as an outer shell has not been studied.
Therefore, the present work was conducted to monitor the prevalence of Aeromonas spp. in the drinking water of broiler chicken farms and assess the antibacterial and/or disinfectant properties of thyme essential oil (TEO), thyme essential oil nano-emulsion (TEO-N), CS, and chitosan nanoparticles (CS-NPs). Additionally, we evaluated the effectiveness of both CS and CS-NP-based coating TEO on isolated Aeromonas spp. to seek an alternative method for establishing an efficient control strategy for biofilm-forming Aeromonas spp.
Materials and methods
Ethical approve
The present study was approved by Institutional Animal Care and Use Committee with issue number: 9215, date:10 December, 2020, Faculty of Veterinary Medicine, Beni-Sue University, Egypt.
Study location and farm description
A cross-sectional design was applied using 12 private broiler chicken farms situated in Beni-Suef (coordinates, 29° 04′ N-31° 05′E) and El-Faiyum Governorate (coordinates, 29° 308374′ N-30° 844105′E). The broiler chickens in these farms were raised on a deep litter system and kept on wood shaving litter at a stocking rate of 7 birds/ m2. Building dimensions were 10.5 x 40.4 meters. Inside the farms, the main water supply was tap water. In addition, the water supply was not treated at all. Water was available from drinkers. Before a production cycle began, all drinkers and water tanks were cleaned and disinfected once per cycle.
Collecting samples
In each city, 150 samples were collected from (water supply, n = 40; water tanks, n = 40; drinkers, n = 40; feedstuff, n = 30) once per week from 6 different locations. All water samples were aseptically collected in sterilized glass bottles (250 mL capacity) from different broiler chicken farms. We collected 25 g of feedstuff samples in sterilized plastic bags; then, they were homogenized in 225 mL of peptone water. The samples were properly labeled and transported in an icebox to the laboratory for further microbiological analysis. Samples were collected for 4 months. All collected samples were used for the selective isolation of Aeromonas bacteria based on standard microbiological procedures (16).
Aeromonas spp. isolation and molecular identification
Tenfold serial dilutions of water and feedstuff samples were prepared; then, 0.1 mL of samples were inoculated on Aeromonas enrichment broth (BD, Becton, Dickinson and Company, Sparks, MD 21152, USA). Thereafter, 10 µL of enrichment broth was aseptically streaked on Aeromonas ampicillin base media (Oxoid, CM 833, SR136) and incubated at 37°C for 24 h. All colonies of green and yellow color were sub-cultured on nutrient agar and incubated again at 37°C for 24 h for further investigation (17). The primary identification of Aeromonas spp. was achieved using morphological characteristics under microscopic examination and motility test (18). Furthermore, polymerase chain reaction (PCR) was used to identifyspecific virulent genes of aerolysin (aerA) and hemolysin (hylH) of Aeromonas spp. (Figure 1) using a method described by (19,20). As shown in Table 1, PCR assay was performed using the oligonucleotide primer. Furthermore, the PCR cycling program was started with denaturation of DNA at 95°C for 5 min, followed by 30 cycles for 2 min at 94°C, then 55°C and 72°C for 1 min, and, finally, final extension at 72°C for 10 min to amplify both aerA and hylH genes.
Table 1: Oligonucleotide primer sequences of target genes in Aeromonas spp
Target gene |
Primer sequences (5'-3') |
Amplified segment |
Reference |
aer A |
Aer 2F: AGCGGCAGAGCCCGTCTATCCA Aer 2R: AGTTGGTGGCGGTGTCGTAGCG |
416 bp |
(18) |
hyl H |
Hyl 2F: GGCCCGTGGCCCGAAGATGCAGG Hyl 2R: CAGTCCCACCCACTTC |
597 bp |
(19) |
Screening of biofilm-forming Aeromonas spp.
Biofilm-forming by Aeromonas spp. was qualitatively detected using the tube method according to (21). The isolated strains of Aeromonas spp. were inoculated into 5 mL of Tryptone Soy Broth (TSB) tubes (Oxoid, UK) and then incubated at 37° C for 48 h. Thereafter, the content of the tubes was decanted and washed with phosphate buffer saline (pH 7) and air-dried. Subsequently, all tubes were stained with 1% crystal violet (% w/v); to ensure uniform staining, tubes were then gently rotated. The stain was removed, and tubes were washed with distilled water and dried in an inverted position. Biofilm formation was considered positive when a visible stained film was observed to adhere to the wall and bottom of the tube. The testing was done in triplicate, and for clarity, results were compared with each other.
Chitosan and chitosan nanoparticles preparation
CS is a powder material (low molecular weight, crab shells, poly-1.4-B-D-glucopyranosamine; 2-amino-2-deoxy-(1 ≥ 4)-B-D-glucopyranan, Kochi 682005, India). CS solution was formulated by dissolving CS 2% (w/v) in 1% (v/v) acetic acid and then stirring the solution for 3 h on a magnetic stirrer at 23°C-25°C to ensure complete dispersal. pH of the solution was adjusted (5.9) by adding a solution of 10N NaOH (31). Thereafter, different concentrations of CS solution were prepared (2, 1.5, 1.25, 1.0, and 0.5 µg/mL). CS-NPs were spontaneously formed upon dropwise addition of an aqueous tripolyphosphate solution (0.25%, w/v) to different CS concentrations with magnetic stirring. CS-NPs were purified by centrifugation at 6000 rpm for 30 min. Supernatants were discarded, and CS-NPs were rinsed with distilled water several times to remove any sodium hydroxide and then freeze-dried before further use (22).
Thyme oil and thyme essential oil nano-emulsion preparation
At different testing concentrations, TEO (100% pure; Sigma-Aldrich, St. Louis, MO, USA) was mixed with Tween 80 (polyoxymethylene sorbitan monolaurate; Sigma-Aldrich) at a concentration of 0.3% to completely dissolve TEO. In addition, the TEO-N was prepared by ultrasonication method where the emulsion of thyme was formulated by joining oil phase (TEO) with aqueous phase (deionized water and Tween® 80 at 3%); then, TEO was slowly added to the aqueous phase at 25°C with a magnetic stirrer at 500 rpm for 15 min. Thereafter, TEO-N was formed using ultrasonicator bath (ASU-10D, AS ONE, Japan) at various temperatures (25°C-30°C) for 15 min according to (23). TEO and TEO-N were prepared at different concentrations (0.15%, 0.25%, 0.5%, 0.75%, and 1%) for further application.
Chitosan-based coating with thyme oil preparation
CS at 2% (w/v) was prepared in acetic acid 1% (v/v). To ensure a complete scattering of CS, the CS solution was stirred for 3 h at 25°C with a magnetic stirrer. The CS solution was placed in a beaker with glycerol at 0.75 mL/g and stirred for 10 min. It was then filtrated using a Whatman filter paper to eliminate undissolved particles. Then, TE mixed with Tween 80 at a concentration of 0.3 was added to the CS solution. The final coating solution consisted of the following: CS, 2%; acetic acid, 1%; glycerol, 0.75%; Tween 80, 0.3%; and TE, 1.0%. Various amounts of TEO were used to prepare different weight ratio of CS to TEO (w/w) of 1:0.15, 1:0.25, 1:0.5, 1:0.75, and 1:1, respectively. Under aseptic conditions, the final CS-based coating oil was homogenized for 2 min at 600 rpm. The solution was prepared without adding TEO as a control (24).
Chitosan nanoparticle-based coating with thyme essential oil preparation
The CS solution at 2% (w/v) in acetic acid 1% (v/v) was prepared by the same previously mentioned method; then, Tween 80 at 0.3% concentration was added as a surfactant to this solution and stirred for 2 h using a magnetic stirrer at 45°C to obtain a homogenous mixture. TEO was then gradually dropped into the CS solution under the stirring condition to obtain oil-in-water emulsion. Various amounts of TEO were used to prepare different weight ratio of CS to TEO (w/w) of 1:0.15, 1:0.25, 1:0.5, 1:0.75, and 1:1%, respectively.The solution of TEO-loaded CS-NPs could be obtained by dropwise addition of an aqueous tripolyphosphate solution (0.25%, w/v) into the oil-in-water emulsion under the stirring condition at room temperature for 1 h using a method described by (25).
Characterization of chitosan nanoparticles and thyme essential oil nano-emulsion and its loaded form
CS-NPs, TEO-N, and its loaded form (CS-NPs/TEO) were characterized using the Fourier transform infrared (FT-IR) spectrophotometer (VERTEX, 70) at the region of 3500-500 cm-1 with a spectral resolution of 4 cm-1. Moreover, the morphological shape and average diameter of CS-NPs, TEO-N, and CS-NPs/TEO were determined using transmission electron microscopy (TEM; a JEOL JEM 2000EX) at the National Research Center (NRC; Central Labs, Egypt) as shown in Figs 2, 3, 4, 5, and 6, respectively.
Testing the antimicrobial activity using the broth microdilution and agar well diffusion assay
The biocidal effects CS, CS-NPs, TEO-N, and its loaded form at different concentrations on the growth rate of Aeromonas spp. isolates (n = 45) were tested. In addition, the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were defined using the broth microdilution assay (26). The freshly prepared dilutions of CS, CS-NPs, TEO-N, and its loaded form in Mueller-Hinton Broth were tested in a 96-well microtiter plate (Nunc, Copenhagen, Denmark). Then, 100 µL of bacterial suspensions (1 x 10-8 CFU/mL) were inoculated in each well. The contents of microtiter plates were mixed by shaking for 10 min and incubated for 24 h at 37°C. The optical density (OD) of each well was monitored using a microplate reader at 600 nm during the incubation time. The difference between OD of each testing sample was compared with negative control (without CS, CS-NPs, TEO-N, and its loaded form); then, MIC and MBC values were assessed. The MIC was revealed as the least concentration of each testing material that avoided visible turbidity in microtiter wells after 24 h. To assess the MBC, 100 mL of the testing sample was transferred from each well without obvious growth to a Mueller-Hinton agar plate and incubated at 37°C for 24 h to confirm the absence of microbial growth. Furthermore, the antibacterial activity of all testing compounds and their loaded form was evaluated using the agar well diffusion method with Mueller-Hinton agar as described by (22).
Statistical analysis
All collected data were prepared in Microsoft Excel Spreadsheet for statistical analysis using the Statistical Package for Social Sciences (SPSS software, version 26). The prevalence rate and distribution of Aeromonas bacterial isolates were analyzed using the Chi-square test (nonparametric test). Meanwhile, one of the parametric tests (one-way ANOVA) was used to determine the diameter of inhibition zone (mm) of testing compounds against Aeromonas spp. isolates. A P-value of < 0.05 was considered statistically significant.
Results
Frequency and distribution rate of Aeromonas spp. in the water distribution system
In the water distribution system and feedstuff of investigated broiler chicken farms, the prevalence rate of Aeromonas spp. was 49.3% (74.0/150). The highest rate of Aeromonas spp. was recorded in water drinkers and tanks 75.0% (30/40) and 62.5% (25/40), respectively), followed by feedstuff and water supply 40.0% (12/30) and 17.5% (7/40), respectively), as shown in Table 2. Additionally, the ability to form a biofilm was confirmed in 20 of 74 positive samples of Aeromonas spp. 27.03% (20/74) at χ2 = 17.2(P<0.01).
Table 2: Prevalence of Aeromonas spp.in the investigated broiler chicken farms
Prevalence rate (%) |
Total |
Examined samples |
|
Positive no. |
Examined no. |
||
17.5 |
7.0 |
40 |
Water supply |
62.5 |
25.0 |
40 |
Water tanks |
75.0 |
30.0 |
40 |
Drinkers |
40.0 |
12.0 |
30 |
Feedstuff |
49.3 |
74.0 |
150 |
Total |
27.03 |
20.0 |
74.0 |
Biofilm-forming bacteria |
The association between positive isolated Aeromonas bacteria and other examined samples is significantly different at Chi-square (χ2) = 17.2,P<0.01.
Figure 1: PCR amplification of the 416-bp fragment of aerolysin gene (aerA) detectedin A. hydrophila (lanes 1, 3, 5, 6, 8, 9, and
11) and hemolysin gene (hylH) amplified at 597-bp fragment (lanes 1, 3, 5, 6, 8, 9, and 11) and control negative at lane 2; DNA: ladder.
Moreover, at all frequency distribution, A. hydrophila was significantly higher than A. caviaein the investigated farms of broiler chickens 74.3% (55/74) and 25.7% (19/74), respectively). The highest frequency of A. hydrophila was detected in water drinkers and feedstuff 80.0% (24/30) and 75.0% (9/12), in comparison with A. caviae, which wasdetected in the highest rate in water supply and water tanks 42.9% (3/7) and 28.0% (7/25), respectively, as shown in Table 3. The distribution of A. hydrophila in water tanks and water supply was 72.0% (18/25) and 57.1% (4/7), respectively, while A. caviae was isolated from feedstuff and water drinkers at 25.0% (3/12) and 20.0% (6/30), respectively. From the total positive biofilm-forming Aeromonas spp., it was found that the highest percentage of biofilm-producing Aeromonas spp. was A. hydrophila 70.0% (14/20) and then A. caviae 30.0% (6/20).
Table 3: Frequency distribution of different Aeromonas spp. in the investigated samples
Frequent distribution of Aeromonas spp. no. (%) |
Total positive no. |
Investigated samples |
|
A. caviae |
A. hydrophila |
||
3.0 (42.9) |
4.0 (57.1) |
7.0 |
Water supply |
7.0 (28.0) |
18.0 (72.0) |
25.0 |
Water tanks |
6.0 (20.0) |
24.0 (80.0) |
30.0 |
Drinkers |
3.0 (25.0) |
9.0 (75.0) |
12.0 |
Feedstuff |
19.0 (25.7) |
55.0 (74.3) |
74.0 |
Total |
6.0 (30.0) |
14.0 (70.0) |
20.0 |
Biofilm-forming bacteria |
The distribution rate of different Aeromonas spp. in the investigated samples is statistically significant at Chi-square (χ2) = 19.3,P<0.01.
Characterization of chitosan nanoparticles, thyme essential oil nano-emulsion, and its loaded form
High-resolution transmission electron microscopy (HR-TEM) images of CS-NPs showed that the nanoparticle (NP) shape was fine spherical and slightly elongated (Figure 2a). In addition, the diameter of NPs ranged from 16.8 to 18.4 nm, as shown in Figure 2b. HR-TEM images of TEO-N showed that the NP shape of thyme oil was typically spherical and elongated and distributed in the field (Figure 3a), and the size of NPs ranged from 150 to 220 nm in diameter, as shown in Figure 3b. HR-TEM images of CS-NPs/TEO showed the spherical and oval shape of NPs distributed in the microscopic field (Figure 4a). The NP diameter ranged from 2.39 to 8.64 nm (Figure 4b). FT-IR spectra of TEO-N (Figure 5a-b) showed the widened peak at 3331.25 cm−1 that approved hydrophilic interaction (H-OH) in TEO-N. Moreover, other peaks were noticed at 1646.34, 1086.55, and 619.29 cm−1. FT-IR spectra of TEO, CS-NPs, and CS-NPs/TEO, as shown in Figure 6 (a-c), showed that a noticed peak of thyme oil (Figure 6a) was obvious at 2955.2, 1706, 1438, 1225, 808, and 586 cm−1. FT-IR spectra of CS-NPs (Figure 6b) showed characteristic peaks that appeared at 3289.6, 2351.9, 1638, 1053, and 600.9 cm−1. The FT-IR spectra of CS-NPs/TEO approved the formation of CS nanoparticle-based coating with thyme oil where characteristic peaks formed at 3272.4, 1642.8, 1045, and 610.4 cm−1 (Figure 6c).
Figure 2: HR-TEM images of CS-NPs show the morphological shape of NPs in CS-NPs (a) that appear as fine spherical and slightly elongated shapes. Additionally, the diameter of NPs (b) ranged from 16.8 to 18.4 nm.
Figure 3: HR-TEM images of TEO-N exhibited the NP shape of thymol oil that appeared as spherical and bean-shaped (a) distributed in the field, and the size of NPs (b) ranged from 150 to 220 nm in diameter.
Figure 4: HR-TEM images of CS-NPs/TEO show the spherical and oval shape (a) of NPs distributed in the microscopic field, and the nanoparticle diameter ranged from 2.39 to 8.64 nm (b).
Figure 5: FT-IR spectra of thyme oil (a) and TEO-N (b).
Figure 6: FT-IR spectrum of TEO (a), CS-NPs (b), and CS-NPs/TEO (c).
Antimicrobial activity of chitosan, thyme oil, and nanocomposites
To evaluate the antibacterial activity of TEO, TEO-N, CS, CS-NPs, chitosan-based coating with thyme oil (CS-TEO), and CS-NPs/TEO, the MIC and MBC of these compounds were determined, as exhibited in Table 4. The MIC for all Aeromonas spp. was CS > CS-NPs > TEO > TEO-N (1.25, 1.0, 0.25, and 0.15 μg/mL, respectively). The MIC value of CS-TEO was barely higher (1:0.25 μg/mL) than that of CS-NPs/TEO (1:0.15 μg/mL). MBC values for all Aeromonas spp. isolates were 2.0, 1.25, 0.75, and 0.5 μg/mL, respectively, in all testing CS > CS-NPs > TEO > TEO-N, while MBC values of both CS-TEO and CS-NPs/TEO were 1:0.5 and 1.025 μg/mL, respectively. In addition, the inhibition zone diameter was significantly evident in Table 4 and Figure 7. The diameter (mm) of inhibition zone for CS-NPs/TEO and CS-NPs was cleared at 34.6 ± 1.5 and 31.5 ± 0.4 mm, followed by TEO-N and CS-TEO (28.9 ± 2.6 and 26.1 ± 2.2 mm, respectively), compared with TEO and CS (24.0 ± 1.3 and 9.3 ± 1.0 mm, respectively) at P≤0.05.
Table 4: Inhibition zone formation using TEO, TEO-N, CS, CS-NPs, CS/TEO, and CS-NPs/TEO against isolated Aeromonas
Well diffusion assay |
Broth microdilution method |
Concentration (µg/mL) |
Testing compound |
|
Inhibition zone diameter (mm) |
MBC (µg/ mL) |
MIC (µg/ mL) |
||
24.0 ± 1.3c |
0.75 |
0.25 |
0.15 0.25 0.5 0.75 1.0 |
Thyme oil |
28.9 ± 2.6b |
0.5 |
0.15 |
0.15 0.25 0.5 0.75 1.0 |
Thyme oil nano-emulsion |
9.3 ± 1.0ab |
2.0 |
1.25 |
0.5 1.0 1.25 1.5 2.0 |
Chitosan |
31.5 ± 0.4a |
1.25 |
1.0 |
0.5 1.0 1.25 1.5 2.0 |
Chitosan nanoparticles |
26.1 ± 2.2b |
1:0.5 |
1:0.25 |
1:0.15 1:0.25 1:0.5 1: 0.75 1:1.0 |
Chitosan-based coating with thyme oil |
34.6 ± 1.5a |
1:0.25 |
1:0.15 |
1:0.15 1:0.25 1:0.5 1: 0.75 1:1.0 |
Chitosan nanoparticle-based coating with thyme essential oil |
The mean values of inhibition zone diameter (mean ± SE) with different superscript letters (a,b,c) in the same column are significantly different at P≤0.05.
Figure 7: The antibiofilm activity of CS, CS-NPs, TEO, TEO-N, CS coating TEO, and CS-NPs/TEO using the well diffusion method shows the effectiveness of TEO-N Aeromonas spp. thatis noticeably clearat different testing concentrations. The inhibition zone diameter was 28.9 ± 2.6 mm compared with thymol oil. CS-NPs exhibited the lethal effect against Aeromonas spp. at 1.25, 1.5, and 2 µg/ mL, respectively, and the inhibition zone was 31.5 ± 0.4 mm in diameter. In addition, CS-NPs/TEO exhibited the lethal effect on biofilm-forming bacteria at a ratio of 1:0.25 µg/ mL, and the inhibition zone was 34.6 ± 1.5 mm, followed by chitosan-based coating with thymol oil at the testing concentration 1:0.5 µg/ mL.
The sensitivity pattern of Aeromonas spp. to different tested compounds and nanocomposites after 24 h of exposure (Table 5) clarified that the effectiveness of TEO on both A. caviae and A. hydrophila was significantly obvious (73.3% and 66.7%, respectively) at the highest tested concentration 1 μg/mL compared with the lowest (0.75, 0.5, 0.25, and 0.15 μg/mL, respectively). The resistance of Aeromonas spp. to TEO exceeded 46.0% at the different tested concentrations (0.5, 0.25, and 0.15 μg/mL, respectively), whereas the resistant percentage was 46.7% (14/30), 53.3% (16/30), and 63.3% (19/30), respectively, compared with resistant isolates of A. caviae at the same tested concentrations (40.0% (6/15), 40.0% (6/15), and 33.3% (5/15), respectively). Furthermore, the susceptibility of Aeromonas spp. to TEO-N exhibited a significant effect at 86.7% (13/15) and 70.0% (21/30) for A. caviae andA. hydrophila at the highest tested concentration (1 μg/mL) compared with other concentrations. The susceptibility of different isolates to CS did not exceed 50.0% (15/30) in the case of A. hydrophila compared with A. caviae (66.7% (10/15)) at a concentration of 2.0 µg/ mL. CS-NPs showed the lethal effect (100%) against all isolated Aeromonas spp. at 1.5 and 2.0 µg/mL compared with the lowest concentrations (1.25, 1.0, and 0.5 µg/ mL, respectively). In contrast, CS-TEO recorded the highest antimicrobial effect on A. caviae (80.0% (12/15)) followed by A. hydrophila (76.7% (23/30)) at a ratio of 1:1 µg/ mL compared with other tested concentrations. On the other hand, the CS-NPs/TEO proved the lethal effect (100% (30/30) and 100% (15/15), respectively) on both A. hydrophila and A. caviae at the ratio of 1:1 and 1:0.75 µg/ mL, respectively. The susceptibility of A. hydrophila was 83.3% (25/30) and 73.3% (22/30), while that of A. caviae was 93.3% (14/15) and 86.7% (13/15), respectively, at ratios of 1:0.5 and 1:0.25 µg/ mL.
Table 5: Antimicrobial activity of TEO, TEO-N, CS, CS-NPs, CS-TEO, and CS-NPs/ TEO against Aeromonas spp
Susceptibility profile of Aeromonas spp. after 24 h of exposure |
concentration (µg/ mL) |
Testing compound |
|||||
A. caviae (n=15) |
A. hydrophila (n=30) |
||||||
Resist |
Intermediate |
Susceptible |
Resist |
Intermediate |
Susceptible |
||
6 (40.0) 6 (40.0) 5 (33.3) 4 (26.7) 3 (20.0) |
5 (33.3) 3 (20.0) 2 (13.3) 2 (13.3) 1 (6.7) |
4 (26.7) 6 (40.0) 8 (53.3) 9 (60.0) 11 (73.3) |
19 (63.3) 16 (53.3) 14 (46.7) 10 (33.3) 8 (26.7) |
6 (20.0) 5 (16.7) 5 (16.7) 3 (10.0) 2 (6.7) |
5 (16.7) 9 (30.0) 11(36.7) 17 (56.7) 20 (66.7) |
0.15 0.25 0.5 0.75 1.0 |
Thyme oil |
4 (26.7) 2 (13.3) 3 (20.0) 2 (13.3) 2 (13.3) |
4 (26.7) 4 (26.7) 3 (20.0) 2 (13.3) 0 (0.0) |
7 (46.7) 9 (60.0) 9 (60.0) 11 (73.3) 13 (86.7) |
15 (50.0) 12 (40.0) 10 (33.3) 10 (33.3) 8 (26.7) |
5 (16.7) 5 (16.7) 3 (10.0) 3 (10.0) 1 (3.3) |
10 (33.3) 13 (43.3) 17 (56.7) 17 (56.7) 21(70.0) |
0.15 0.25 0.5 0.75 1.0 |
Thyme oil nano-emulsion |
6 (40.0) 6 (40.0) 5 (33.3) 4 (26.7) 4 (26.7) |
4 (26.7) 3 (20.0) 3 (20.0) 2 (13.3) 1 (6.7) |
5 (33.3) 6 (40.0) 7 (46.7) 9 (60.0) 10 (66.7) |
23 (76.7) 21 (70.0) 19 (63.3) 15 (50.0) 15 (50.0) |
3 (10.0) 3 (10.0) 2 (6.7) 2 (6.7) 0 (0.0) |
4 (13.3) 6 (20.0) 9 (30.0) 13 (43.3) 15 (50.0) |
0.5 1.0 1.25 1.5 2.0 |
Chitosan |
4 (26.7) 2 (13.3) 1 (6.7) 0 (0.0) 0 (0.0) |
1 (6.7) 1 (6.7) 0 (0.0) 0 (0.0) 0 (0.0) |
10 (66.7) 12 (80.0) 14 (93.3) 15 (100) 15 (100) |
13 (43.3) 10 (33.3) 7 (23.3) 0 (0.0) 0 (0.0) |
7 (23.3) 5 (16.7) 4 (13.3) 0 (0.0) 0 (0.0) |
10 (33.3) 15 (50.0) 19 (63.3) 30 (100) 30 (100) |
0.5 1.0 1.25 1.5 2.0 |
Chitosan nanoparticles |
5 (33.3) 5 (33.3) 4 (26.7) 4 (26.7) 3 (20.0) |
4 (26.7) 3 (20.0) 2 (13.3) 2 (13.3) 0 (0.0) |
6 (40.0) 7 (46.7) 9 (60.0) 9 (60.0) 12 (80.0) |
18 (60.0) 15 (50.0) 15 (50.0) 12 (40.0) 7 (23.3) |
2 (6.7) 2 (6.7) 1 (3.3) 1 (3.3) 0 (0.0) |
10 (33.3) 13 (43.3) 14 (46.7) 17 (56.7) 23 (76.7) |
1:0.15 1:0.25 1:0.5 1: 0.75 1:1 |
Chitosan-based-coating with thyme oil |
2 (13.3) 2 (13.3) 1 (6.7) 0 (0.0) 0 (0.0) |
1 (6.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) |
12 (80.0) 13 (86.7) 14 (93.3) 15 (100) 15 (100) |
9 (30.0) 5 (16.7) 3 (10.0) 0 (0.0) 0 (0.0) |
4 (13.3) 3 (10.0) 2 (6.7) 0 (0.0) 0 (0.0) |
17 (56.7) 22 (73.3) 25 (83.3) 30 (100) 30 (100) |
1:0.15 1:0.25 1:0.5 1: 0.75 1:1 |
Chitosan nanoparticle-based coating with thyme essential oil |
The association of susceptibility testing of Aeromonas spp. and different testing compounds (TEO, TEO-N, CS, CS-NPs, and its loaded form) is statistically significant at P≤0.05.
Discussion
It is very imperative to combat Aeromonas spp. as an emerging water pathogen. Most Aeromonas strains could produce different putative virulence factors, such as enterotoxins, cytotoxins, or hemolysins (6,27). Furthermore, both fish and chicken play a serious role in pathogen transmission to human beings (28). The present work clarified that the prevalence rate of Aeromonas spp. isolates was significantly high in water drinkers and tanks, followed by feedstuff, at the broiler chicken farm level at PA. hydrophila was significantly higher than A. caviaein the investigated farms. Mailafia and Agbede (2)found that there were a wide variety of bacteria, including A. hydrophila 6.67% and P. aeruginosa 25%, in drinking water supplies. The existence of A. hydrophila within the water distribution system provided the opportunity to multiply (28) and they could mutate in the water supply that provided the appropriate conditions to the microorganisms to produce virulent genes (3,6). Aeromonas hydrophila is a potential waterborne pathogen that could cause an increase of infection in livestock, laboratory animals, fishes, wildlife, and chickens (5). There are some hazardous factors, such as ingestion of contaminated drinking water and food, presented by such microorganisms that are predisposed to cause several human diseases (29). Additionally, A. hydrophila is considered an important human pathogen linked with foodborne disease outbreaks (30). Previous literature reported that A. hydrophila could be horizontally transmitted through an oral route, including unhygienic feed sources and contaminated drinking water sources (31). The ability of Aeromonas bacteria to produce biofilm was recorded in this study, where the highest percentage of biofilm-producing Aeromonas spp. was A. hydrophila, followed by A. caviae, that was isolated from water tanks and drinkers. These findings could be attributed to the unhygienic water source and/or accumulation of biofilm-forming bacteria on the inner surface of the water tanks and drinkers. This could occur when hygienic and sanitation rules are not applied in the broiler chicken farms to protect the birds from the risk of exposure to such bacterial contaminants through drinking contaminated water and feed. Scwab and Straus(33)found that the accumulation of biofilms on the inner surface of water distribution systems led to additional contamination of water in the pipes, and an increase in the concentration of Aeromonas bacteria in the water was attributed to factors including inadequate water treatment and unhygienic water sources (34).
The effectiveness of TEO on both A. caviae and A. hydrophila was significantly low at the tested concentration of 1.0 µg/mL, but the resistance of Aeromonas spp. to TEO exceeded 46.0% at the different tested concentrations during this study. Donsì and Ferrari (35) clarified that the use of EOs was considered a promising alternative to chemical sanitizers. Puvaca et al. (7) stated that in the treatment of bacterial infections, there are a viable alternative to synthetic drugs involve many aromatic and medicinal plants, and herbs have been proposed as a significant source of natural antimicrobials. Regarding the sensitivity pattern of Aeromonas spp. to CS, it has been discovered that the efficiency of CS did not exceed 50% in the case of A. hydrophila compared with A. caviae at the highest tested concentration of 2.0 µg/ mL.Chavez de Paz et al. (36)found that low molecular weight CS had a high antibacterial effect of more than 95%, especially against Streptococcus mutans that produce biofilms. The germicide activity of CS can be attributed to a change in cell permeability due to interactive action between the amine groups of CS and the electronegative charges on the exterior of the microbial cell.
Biofilm-forming bacteria are a foremost problem in food production due to their resistance to disinfectants. EO nano-emulsions could reduce biofilms that are formed via the accretion of microorganisms on the surface.Moreover, nano-emulsion efficiency can inhibit the biofilm-forming activity by preventing the bacterial attachment on the surface (37). It was recently found that EO encapsulation in nanoscale exhibited a potential to enhance EOS bioactivity via the activation of the cell absorption mechanism. Due to subcellular size, nanoscale encapsulation can increase the bioactive compound concentration in food zones where microbes are preferably situated (38). Li et al. (39) noticed that the use of TEO-N led to a reduction in the biofilms produced by foodborne pathogens on food surfaces of romaine lettuce and blueberries within 60 s of washing with oil nano-emulsion.
Creating a new formula based on CS was aimed at enhancing the hydrophilic properties of polymer (40). In this context, the application of CS-NPs alone or in combination as a coating material (CS-NPs/TEO) proved the lethal effect on bacterial isolates (100%) at two of five tested concentrations. Therefore, the coating of TEO with CS-NPs was highly effective for inhibiting the growth of all Aeromonas spp. isolates at a ratio of 1:1 and 1:0.75 µg/ mL, respectively, compared with the least tested concentrations. In contrast, Ibrahim et al. (41) stated that CS-NPs could prevent the growth of both Gram-positive and Gram-negative bacteria. El-Wafai et al. (42) found that, in the case of Aeromonas veronii, the diameter of inhibition zone increased when the CS-NP concentration was increased at 2.0 μg/mL. Previous literature stated that the small-sized droplets of nano-emulsion enhanced the antimicrobial efficacy due to increased surface areas that allowed its penetration into the outer cell wall of bacteria (35). In the current study, the diameter of TEO-N ranged from 150 to 200 nm, while the NP diameter ranged from 16.8 to 18.4 nm in CS-NPs. On the other hand, Mohammadi et al. (25) found that using cinnamon oil/CS nanoparticle coating enhanced the physicochemical and microbial features of cucumbers and lowered microbial count during storage. Sessa et al. (43) observed that the effectiveness of nano-emulsion-based coatings (modified CS containing lemon oil nano-emulsion) on rucola leaf shelf-life was much better than when using lemon oil and/or CS coating alone, extending the shelf-life up to 7 days.
Conclusion
The results obtained in this study are considered promising, with a product that can be exploited for the control of biofilm-producing Aeromonas spp. The use of CS-NPs alone and/or the coating of TEO with CS-NPs was quite effective in inhibiting growth (100%) of all Aeromonas spp. isolates at a ratio of 1:1 and 1:0.75 µg/ mL. Additionally, it can be applied as a disinfectant product and/or antimicrobial agent for the treatment of a drinking water distribution system; it also acts as a decontaminator for water tanks and drinkers at the poultry farm level.
Acknowledgment
All thanks and appreciation to all workers of examined farms for helping us in collecting the investigated samples during the study period.
Conflict of interest
The authors declare that there are no competing interests.
10. de Oliveira CEV, Magnani M, de Sales CV, de Souza Pontes AL, Campos- Takaki GM, et al. Effects of chitosan from Cunninghamella elegans on virulence of post-harvest pathogenic fungi in table grapes (Vitis labrusca L.). Int J Food Microbiol. 2014; 171: 54-61. Doi: 10.1016/j.ijfoodmicro.2013.11.006
11. Wang W, Meng Q, Li Q, Liu J, Zhou M, Jin Z, Zhao K. Chitosan derivatives and their application in biomedicine. Int J Mol Sci. 2020; 21: 487. Doi:10.3390/ijms21020487.
12. Kammoun M, Haddar M, Kallel TK, Dammak M, Sayari A. Biological properties and biodegradation studies of chitosan biofilms plasticized with PEG and glycerol. Int J Biol Macromol. 2013; 62: 433-438. Doi: 10.1016/j.ijbiomac.2013.09.025
13. Hernandez-Lauzardo AN, Vel_azquezedel Valle MG, Guerra-Sanchez MG. Current status of action mode and effect of chitosan against phytopathogens fungi. Afr J Microbiol Res. 2011; 5(25): 4243-4247. Doi: 10.5897/AJMR11.104
14. Keawchaoon L, Yoksan R. Preparation, characterization and in vitro release study of carvacrol-loaded chitosan nanoparticles. Colloids Surf B Biointerfaces. 2011; 84(1):163-71. Doi: 10.1016/j.colsurfb.2010.12.031
15. South African National Standards (SANS). “Drinking water—part 1: microbiological, physical, chemical, aesthetic and chemical determinands,” SABS Standards Division, Pretoria, South Africa, 2011.
16. Ashiru AW, Uaboi-Egbeni PO, Oguntowo JE, Idika CN. Isolation and antibiotic profile of Aeromonas species from tilapia fish (Tilapia nilotica) and catfish (Clarias betrachus). Pak J Nutr. 2011; 10 (10): 982-986. Doi: 10.3923/pjn.2011.982.986
17. Collins CH, Lyne PM. Microbiological methods 5th microbiology laboratory manual, British Liberary, Butter Wort Inc., London, UK, 1984.
18. Kaszab E, Szoboszlay S, Dobolyi C, H´ahn J, P´ek N, Kriszt B. “Antibiotic resistance profiles and virulence markers of Pseudomonas aeruginosa strains isolated from composts”.Bioresource Technol. 2011; 102 (2):1543-1548. Doi: 10.1016/j.biortech.2010.08.027
19. Yousr AH, Napis S, Rusul GRA, Son R. “Detection of aerolysin and hemolysin genes in Aeromonas spp. isolated from environmental and shellfish sources by polymerase chain reaction.” ASEAN Food. 2007; J 14(2):115-122.
20. Christensen GD, Simpson WA, Bisno AL, Beachey EH. Adherence of slime - producing strains of Staphylococcus epidermidis to smooth surfaces. Infect Immum. 1982; 37 (1): 318-326. Doi: 10.1128/IAI.37.1.318-326.1982
21. Tsai GJ, Su WH. Antibacterial activity of shrimp chitosan against Escherichia coli. J Food Prot. 1999; 62(3): 239-243. Doi: 10.4315/0362-028x-62.3.239
22. Qi L, Xu Z, Jiang X, Hu C, Zou X. Preparation and antibacterial activity of chitosan nanoparticles. Carbohydrate Res. 2004; 339(16): 2693-2700. Doi: 10.1016/j.carres.2004.09.007
23. Pongsumpun P, Iwamoto S, Siripatrawan U. Response surface methodology for optimization of cinnamon essential oil nanoemulsion with improved stability and antifungal activity. Ultrason Sonochem. 2019; 60 (2020) 104604. Doi: 10.1016/j.ultsonch.2019.05.021
24. Ojagh SM, Rezaei M, Razavi SH, Hosseini SMH. Effect of chitosan coatings enriched with cinnamon oil on the quality of refrigerated rainbow trout. Food Chemistry. 2010; 120(1): 193-198. Doi: 10.1016/j.foodchem.2009.10.006
25. Mohammadi A, Hashemi M, Hosseini SM. “Chitosan nanoparticles loaded with Cinnamomum zeylanicum essential oil enhance the shelf life of cucumber during cold storage. Postharvest Biol Technol. 2015; 110: 203-213. Doi: 10.1016/j.postharvbio.2015.08.019.
26. CLSI. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved Standard-Ninth Edition. CLSI document M07-A9. Wayne, PA: Clinical and Laboratory Standards Institute, 2012. https://clsi.org/media/1928/m07ed11_sample.pdf
27. Taha ZM, Sadiq ST, Khalil WA, Ali KY, Yosif HS, Shamil HN. Investigation of gcat gene and antibiotic resistance pattern of Aeromonas hydrophila isolated from hemorrhagic septicemia’s cases in fish farms. Iraqi J Vet Sci. 2021; 35: 375-380. Doi: 10.33899/ijvs.2020.126876.1405
28. Praveen PK, Debnath C, Shekhar S, Dalai N, Ganguly S. Incidence of Aeromonas spp. infection in fish and chicken meat and its related public health hazards: Vet World. 2016; 9 (1): 6-11. Doi: 10.14202/vetworld.2016.6-11
30. Kumar S, Mulchopadhyay P, Chatterjee M, Bandyopadhyay M, Ghosh T, Samaddar D. Necrotizing fascilitis caused by Aeromonas Caviae. Avicenna J Med. 2012; 2:94. Doi: 10.4103/2231-0770.110740
31. Awaad, MH, Hatem ME, Wafaa A, Asia E, Fathi A. Certain epidemiological aspects of Aeromonas hydrophila infection in chickens. J Am Sci. 2011; 7:761-770. Doi: http://www.americanscience.org.
32. Dashe YG, Raji MA, Abdu PA, Oladele BS, Olarinmoye D. Isolation of Aeromonas hydrophila from Commercial Chickens in Jos Metropolis, Nigeria. Int J Poult Sci. 2014; 13 (1) 26-30. Doi: 10.3923/ijps.2014.26.30
33. Scwab CJ, Straus DC. The roles of Penicillium and Aspergillus in sick buildings syndrome.Adv Appl Microbiol. 2004; 55:215-237. Doi: 10.1016/S0065-2164(04)55008-6
34. Auwal H, Taura DW. Prevalence of moulds in households drinking water of some local government areas of Kano. Nigeria. Greener Biol Sci. 2013; 3(5):179-186. Doi: 10.15580/GJBS.2013.5.032613546
35. Donsì F, Ferrari G. Essential oil nanoemulsions as antimicrobial agents in food. J Biotechnol. 2016; 233: 106-120. Doi: 10.1016/j.jbiotec.2016.07.005
36. Chavez de Paz LE, Resin A, Howard KA, Sutherland DS, Wejse PL. Antimicrobial effect of chitosan nanoparticles on Streptococcus mutans biofilms. Appl Environ Microbiol. 2011; 77 (11): 3892-3895. Doi: 10.1128/AEM.02941-10
37. Shahabi N, Tajik H, Moradi M, Forough M, Ezati P. Physical, antimicrobial and antibiofilm properties of Zataria multiflora Boiss essential oil nanoemulsion. Int J Food Sci Technol. 2017; 52: 1645-16. Doi: 10.1111/ijfs.13438.
38. Donsì F, Annunziata M, Vincensi M, Ferrari G. Design of nanoemulsion based delivery systems of natural antimicrobials: Effect of the emulsifier. J Biotechnol. 2012; 159: 342-350. Doi: 10.1016/j.jbiotec.2011.07.001.
39. Li J, Chang JW, Saenger M, Deering A. Thyme nanoemulsions formed via spontaneous emulsification: Physical and antimicrobial properties. Food Chemistry. 2017; 232: 191-197. Doi: 10.1016/j.foodchem.2017.03.147
40. Han J, Guenier AS, Salmieri S, Lacroix M. Alginate and chitosan functionalization for micronutrient encapsulation. J Agric Food Chem. 2008;56: 2528-2535. Doi: 10.1021/jf703739k.
41. Ibrahim HM, El-Bisi MK, Taha GM, El-Alfy EA. Chitosan nanoparticles loaded antibiotics as drug delivery biomaterial. J Appl Pharma Sci. 2015; 5 (10): 085-090. Doi: 10.7324/JAPS.2015.501015
42. El-Wafai NA, El-Zamik FI, Mahgoub SA M and Atia AMS (2020) Isolation of Aeromonas bacteriophage AvF07 from fish and its application for biological control of multidrug resistant local Aeromonas veronii AFs2. Zagazig J Agric Res. 2020; 47 (1): 179-197. Doi: 10.21608/zjar.2020.70242.
43. Sessa M, Ferraria G, Donsìb F. Novel edible coating containing essential oil nanoemulsions to prolong the shelf life of vegetable products. Chem Eng Trans. 2015; 43: 55-60. Doi: 10.3303/CET1543010