College of Veterinary Medicine / University of Mosul
  • Register
  • Login
  • العربیة

Iraqi Journal of Veterinary Sciences

Notice

As part of Open Journals’ initiatives, we create website for scholarly open access journals. If you are responsible for this journal and would like to know more about how to use the editorial system, please visit our website at https://ejournalplus.com or
send us an email to info@ejournalplus.com

We will contact you soon

  1. Home
  2. Volume 35, Issue 2
  3. Authors

Current Issue

By Issue

By Subject

Keyword Index

Author Index

Indexing Databases XML

About Journal

Aims and Scope

Editorial Board

Editorial Staff

Facts and Figures

Publication Ethics

Indexing and Abstracting

Related Links

FAQ

Peer Review Process

News

Prevalence and molecular investigation of caseous lymphadenitis among the slaughtered sheep at Duhok Abattoirs; experimental infection with Corynebacterium pseudotuberculosis in rabbits

    Nawzat Issa Rezheen Fatah Zanan Taha Muhammad Hussen Kareem Kareem Handren Hamadamin Zirak Najeeb Bahroz Ahmed Hivi Hameed

Iraqi Journal of Veterinary Sciences, 2021, Volume 35, Issue 2, Pages 263-270
10.33899/ijvs.2020.126772.1377

  • Show Article
  • Highlights
  • Full Text
  • References
  • Download
  • Cite
  • Statistics
  • Share

Abstract

Caseous lymphadenitis is a chronic infection caused by Corynebacterium pseudotuberculosis that affects the lymphatic system, resulting in abscesses in the lymph nodes and internal organs. This study was conducted to determine the prevalence rate of caseous lymphadenitis among slaughtered sheep in Duhok abattoirs, Duhok, Iraq and to investigate to what extend rabbits can develop caseous lymphadenitis just like that in sheep. A total of 1052 carcasses of sheep were randomly selected (939 males and 113 females) and carefully inspected for detection any suspected caseous lymph adenitis. The isolated Corynebacterium pseudotuberculosis from lymph nodes of sheep carcasses were identified by PCR before used in in vivo infection in rabbits. Data revealed that the prevalence rate of caseous lymphadenitis was at 1.9% among the slaughtered sheep and the prevalence rates were higher in females and older ages than that of males and younger ages, respectively. Experimentally infected rabbits developed various clinical signs were ranging from in inappetence to sudden death, mainly during first week of infection. Histopathologically, the infected rabbits developed caseous lymphadenitis and pyogranuloma after a time point of 10 days post-infection. Liver, spleen and lymph nodes of infected rabbits showed caseo-necrotic foci with multiple micro-granulomas with presence of thick pyogenic membrane infiltrated with leukocytic cells; these findings are strictly resemblance to that reported in sheep. The obtained preliminary data of using rabbits as an animal model is promising which will enhance a better understanding the pathogenesis of caseous lymphadenitis in animals.
Keywords:
    Caseous lymphadenitis sheep Corynebacterium pseudotuberculosis in vivo in rabbits
Main Subjects:
  • Infectious and Epidemic Animal Diseases

Prevalence and molecular investigation of caseous lymphadenitis among the slaughtered sheep at Duhok Abattoirs; experimental infection with Corynebacterium pseudotuberculosis in rabbits

 

N.A. Issa1, R.F. Abdulrahman2, Z.M. Taha2, M.M. Hussain1, K.H. Kareem1, H.I. Hamadamin1, Z.D. Najeeb1, B.M. Ahmed1 and H.M. Hameed1

 

1Surgery and Internal Medicine department, 2Pathology and Microbiology Department, College of Veterinary Medicine, University of Duhok, Iraq

 

nawzat.issa@uod.ac

 

ORCID:

Nawzat. A. Issa: 0000-0002-8171-1546

Rezheen F. Abdulrahman: 0000-0002-9308-878X

Zanan M Taha: 0000-0001-5512-6338

 

2020-03-07

2020-04-28

 

Abstract

Caseous lymphadenitis is a chronic infection caused by Corynebacterium pseudotuberculosis that affects the lymphatic system, resulting in abscesses in the lymph nodes and internal organs. This study was conducted to determine the prevalence rate of caseous lymphadenitis among slaughtered sheep in Duhok abattoirs, Duhok, Iraq and to investigate to what extend rabbits can develop caseous lymphadenitis just like that in sheep. A total of 1052 carcasses of sheep were randomly selected (939 males and 113 females) and carefully inspected for detection any suspected caseous lymph adenitis. The isolated Corynebacterium pseudotuberculosis from lymph nodes of sheep carcasses were identified by PCR before used in in vivo infection in rabbits. Data revealed that the prevalence rate of caseous lymphadenitis was at 1.9% among the slaughtered sheep and the prevalence rates were higher in females and older ages than that of males and younger ages, respectively. Experimentally infected rabbits developed various clinical signs were ranging from in inappetence to sudden death, mainly during first week of infection. Histopathologically, the infected rabbits developed caseous lymphadenitis and pyogranuloma after a time point of 10 days post-infection. Liver, spleen and lymph nodes of infected rabbits showed caseo-necrotic foci with multiple micro-granulomas with presence of thick pyogenic membrane infiltrated with leukocytic cells; these findings are strictly resemblance to that reported in sheep. The obtained preliminary data of using rabbits as an animal model is promising which will enhance a better understanding the pathogenesis of caseous lymphadenitis in animals.

 

Keywords: Caseous lymphadenitis, sheep, Corynebacterium pseudotuberculosis, in vivo in rabbits

 

 الانتشار والتحری الجزیئی لالتهاب العقد اللمفیة التجبنی للأغنام المذبوحة فی مجازر دهوک؛ الإصابة التجریبیة بجراثیم السل الکاذب فی الأرانب

 

نوزت ابوزید عیسى1، ریژین فتاح عبدالرحمن2، زانان محمد أمین طه2، محمد مقداد حسین1، کریم هیرش کریم1، هەندرێن ابراهیم حمد1، زیرک دیوالى نجیب1، بەهرۆز محمود احم1 و هیڤى مقداد حمید1

 

فرع الطب الباطنی والجراحة، فرع الأمراض والأحیاء المجهریة، کلیة الطب البیطری، جامعة دهوک، العراق

 

الخلاصة

یعد التهاب العقد اللمفیة التجبنی من الأمراض المزمنة التی تسببها جراثیم السل الکاذب وتؤثر عللى الجهاز اللمفی مما یؤدی الى تکوین خراجات فی العقد اللمفیة والاعضاء الداخلیة. أجریت هذه الدراسة لتحدید مدى انتشار التهاب العقد اللمفیة التجبنی فی الأغنام المذبوحة فی مجازر دهوک واحداث الاصابة تجریبیا فی الارانب والتعرف على مدى قابلیتها على الإصابة بالتهاب العقد اللمفیة التجبنی کما هو الحال فی الأغنام. تم فحص ذبائح الأغنام المختارة عشوائیا والبالغ عددها 1052 (939 ذکور و 113 اناث) عیانیا بعنایة تامة للتعرف على وجود التهاب العقد اللمفیة التجبنی. تم التعرف على جراثیم السل الکاذب فی العقد اللمفیة لذبائح الاغنام باستخدام تقنیة تفاعل البلمرة المتسلسل قبل البدء بالإصابة التجریبیة فی الأرانب. أظهرت نتائج الدراسة أن نسبة انتشار التهاب العقد اللمفیة التجبنی فی الاغنام المذبوحة 1.9% واعلى نسبة للاصابة تم تسجیلها فی الاناث والحیوانات المتقدمة بالعمر مقارنة بالذکور والاعمار الصغیرة على التوالی. واظهرت الاصابة التجریبیة فی الارانب ظهور اعراض مرضیة وبمعدلات متفاوتة من فقدان الشهیة الى الموت المفاجئ، اغلبها فی الاسبوع الاول من الاصابة. اما التغیرات المرضیة النسیجیة فی الارانب المصابة تجریبیا اظهرت حدوث التهاب العقد اللمفیة التجبنی واورام قیحیة بعد 10 ایام من الاصابة. الکبد، الطحال والعقد اللمفیة للارانب المصابة اظهرت وجود بؤر نخریة تجبنیة وأورام صغیرة متعددة مع وجود قیح وارتشاحات للخلایا البیضاء. وکانت هذة التغیرات مشابة للتغیرات المسجلة فی الاغنام. استنتج من البیانات الأولیة لهذة الدراسة انة من الممکن استخدام الارانب للتعرف وتفهم الامراضیة لالتهاب العقد اللمفیة التجبنی فی الحیوانات.

Introduction

 

Caseous lymphadenitis (CLA) is a chronic, contagious bacterial disease caused by the bacterium Corynebacterium pseudotuberculosis (C. pseudotuberculosis). It is manifested clinically as abscesses of peripheral and/or internal lymph nodes and organs (1). The pus content of the infected lymph nodes is very thick and with no smell (2). Whereas, the peripheral form presents as abscesses of single or multiple peripheral palpable lymph nodes, internal CLA typically manifests as chronic weight loss and ill thrift (3). Although prevalence of CLA varies by region and country, it is found worldwide (4). The disease found within two forms, the external which is more common in goats and the enteral form is common in sheep (5). The disease is economically very important and it associates with great economic losses ranging from reduction within the meat and milk productions, damage of carcasses to death (6).

Little evidences are available on the prevalence of the disease among the small ruminant in Iraq; however, the prevalence rate of CAL in sheep was reported in a study among the clinically examined adult sheep in Baghdad at rate of 2.55% (7), and at 15.12% in another study by using ELISA (8). Nothing was known on the prevalence rate of the disease among sheep in Duhok area; the effect of the sex and age of infected animals on the prevalence rate of the disease was also unknown.

More studies in depth have been recommended to be conducted to understand the pathogenesis of CLA; the disease is contagious in its nature and its response to the antibacterial antibiotics is poor, besides its control is difficult due to the lack of effective control program (9). The pathogenesis of the diseases in sheep are still not fully understood (10). However, sheep and goats have been used in vivo as animals modelsto study the immune responses and to evaluate antibacterial activities of some drugs against C. pseudotuberculosis (11,12). Guinea pig and mice were also used to study immune responses against Corynebacterium pseudotuberculosis (13), mice were infected with different strains of C. pseudotuberculosis of equine origin for better understanding the clinical signs, microbiological and pathological outcomes of CLA infection (14,15).

Using large animals like sheep and goats as a model to study the pathogenesis of CLA is usually costly and hard to be handling, alternatively, laboratory animals like rabbits are cheap and easily handbill (14). Therefore, the present study was carried out to determine the prevalence rate of the disease among slaughtered sheep in Duhok province and to investigate the potential uses of rabbit as a model for in vivo studies of Corynebacterium pseudotuberculosis infection in rabbits following the oral route.

 

Materials and methods

 

Animals and samples collection

From September 2019-January 2020, a total of 1052 carcasses of sheep were randomly selected (939 males and 113 females) and inspected at Duhok abattoirs. The carcasses were carefully inspected and any suspected CLA were removed and transported in clean sterile specimen containers (Ayset®, Turkey) kept in cold box to the Duhok research Center at the college of Veterinary Medicine, University of Duhok, Iraq for bacterial isolation.

 

Isolation and Identification of Corynebacterium pseudotuberculosis

Samples were collected aseptically from the suspected CLA abscessed lymph nodes in order to prevent the contamination from the surface of lymph node and environment. Abscessed lymph nodes were cut using sterile disposable blade and pus were collected and cultured onto 5% sheep blood agar. The plates were incubated at 37°C for 24-48 h. Primary identification was based on standard microbiology methods including Gram stain of pus, colony morphology, and hemolytic activity of the grown bacteria (16,17). Suspected colonies of C. pseudotuberculosis were selected and streaked onto blood agar plate to obtain pure colonies of C. pseudotuberculosis. Gram stain and biochemical tests including catalase and urease tests were also used to confirm presumptive identification of C. pseudotuberculosis. 50% (v/v) glycerol in brain heart infusion broth were prepared and used to store pure cultures of C. pseudotuberculosis at -20°C for further analysis.

The identification of suspected C. pseudotuberculosis isolates were further confirmed by PCR. For DNA extraction, isolates were plated out onto 5% sheep blood agar from -20°C glycerol stocks and incubated at 37°C for 48 h. DNA was extracted using thermal lysis method as described by (18). Briefly, 10 colonies were resuspended in 500 µl of TAE buffer and mixed very well. Thermal lysis was performed in heating block for 11 to 15 min. The suspension was cooled for 4 min at 4°C then centrifuged at 14,000 g for 2 min. The supernatant was then used as the DNA template. Prepared DNA was checked for purity using NanoDrop 2000C spectrophotometer (Thermo Scientific/ UK) and kept at -20°C for PCR.

Primers targeting pld gene of C. pseudotuberculosis were obtained from previously published work (19). The pld gene was amplified using a total reaction volume of 20 µl. Each reaction consisted of 10 µl of master mix, 1 µl of each forward and reverse primer at concentration of 10 pmol µl-1 (PLD-F: 5´ATAAGCGTAAGCAGGGAGCA´3; PLD-R2: 5´ATCAGCGGTGATTGTCTTCCAGG´3), 2 µl of template DNA and 6 µl dH2O. Reactions were carried out in a Gene Amp PCR System 9700 Thermo Cycler (Applied Biosystems). The following parameters of 40 cycles were used according to (19): initial denaturation at 95 ºC for 3 min, denaturation at 95 ºC for 1 min, annealing at 58 ºC for 40 s, extension at 68 ºC for 90 s and final extension at 68 ºC for 7 min. Amplification products were separated by electrophoresis on 1% (w/v) agarose gel containing Prime Safe Dye (GeNet Bio, Korea). The fragment sizes were visualized under UV light.

 

Rabbits and inocula preparation for in vivo infection

Fifteen clinically healthy rabbits at age of two months were purchased from the local markets in Erbil, Iraq, and brought to animals’ house at the College of Veterinary Medicine, University of Duhok, Iraq. The rabbits were acclimatized to the local environmental condition for a period of a week before conducting the infection experimentally. The rabbits were fed on leafy green vegetables and bread. This study was firstly approved by Animal Ethical Committee at the College of Veterinary Medicine, University of Duhok, Iraq.

 

Inoculant preparation

Following molecular confirmation of the isolated Corynebacterium pseudotuberculosis from the CLA of the mediastinal lymph nodes of slaughtered carcasses of sheep, a bacterial suspension as inocula was prepared in brain heart infusion broth (Himedia, India) containing 10% of sheep serum to enhance the bacterial growth. Inoculated broth was incubated at 37ºC for 24h at 150 revolutions per minute (rpm) in shaker incubator (Stuat, UK). The bacteria were grown to a concentration of approximately 108 bacteria per ml depending on the optical density. The challenge doses of the bacteria 1x107 colony forming unit CFU/ml were determined using 1 ml of the bacterial suspension which was transferred in a 15 ml centrifuge tube and centrifuged at 1000x g for 10 min using macro-centrifuge (Volker, Germany). The supernatant was discarded and the cell pellet was re-suspended in 1% PBS according to the required challenge dose which was calculated by measuring the optical density of bacterial cultures at 600 nm by spectrophotometer (Biochrome Ltd, England) and comparing the bacterial CFU number were determined by using the Miles and Misra method (20).

 

Experimental design

To detect the potential of developing of CLA in rabbit by the isolated Corynebacterium pseudotuberculosis from sheep, 12 rabbits out of 15 were experimentally infected; the infected rabbits were orally infected with 1x107 CFU/ ml. The rest 3 rabbits left non-infected as a control group; the infected and non-infected animals were kept under observation during the period of the experiment (two months).

 

Post-infection and histopathological changes

Five rabbits from the infected group were sacrificed after ten days post-infection and their internal organs (lymph nodes, liver and spleen) were removed and cleaned with 1% PBS for bacterial isolation and for histopathological study using Hematoxylin and Eosin (H&E) staining protocol. The time point of 10 days post-infection for histopathological study was chosen according to the previous studies (21,22) who found that pyogronulomas in response to Corynebacterium pseudotuberculosis were developed within 10 post experimental infection in goats. For bacterial isolation, the cleaned tissues were weighted firstly and homogenized with an equal amount of 1 % PBS (w/v) in 1.5 ml standard centrifuge tubes using electric miller (Coyote, China) and followed by two-fold serial dilutions in micro well plates and then cultured on blood agar as mentioned before. For histopathological study, cleaned tissues of the removed organs were fixed in 10 % formaldehyde for a week and then processed with H&E staining protocol (23, 24,25, 26).

 

Results

 

Prevalence rate of CLA among slaughtered sheep

The data found that 20 out of 1052 of inspected carcasses of sheep were infected with CLA at prevalence rate 1.9%; among the age groups, the data revealed that the prevalence rates were higher in sheep at age of three years and older than that found in sheep of younger ages. With regards to the gender of the inspected carcasses, the highest rate was reported in females at 10.61% compared to that in males at 0.85% (Table 1).

 

Table 1: The prevalence rate of CLA among age and sex groups of slaughtered sheep in Duhok abattoirs

 

Sheep carcasses

Inspected carcasses

Prevalence rate%

Negative

Positive

 Age

 

98.67%

(740/750)

1.33%

(10/750)

1.33%

≥3 years

96.69%

(292/302)

3.31%

(10/302)

3.31%

 Sex

Males

99.15%

(931/939)

0.85%

(8/939)

0.85%

Females

89.38%

(101/113)

10.61%

(12/113)

10.61%

 

During the carcasses inspection, CLA of the mediastinal lymph nodes were found in variable sizes and contents, the pus was cheesy, creamy -milky to pale green in color as shown in (Figure 1).

 

 

 

Figure 1: Mediastinal lymph node with caseous abscesses of slaughtered sheep; the abscess was about 7 cm in diameter contained thick creamy pale green - smell less pus.

 

Isolation and Identification of C. pseudotuberculosis

Based on colony morphology, Gram staining and biochemical tests all of the grown bacteria were identified as C. pseudotuberculosis; where the colonies on blood agar appeared white, small, dry and non-hemolytic at 24 h incubation as shown in (Figure 2A). However, after 48 the colonies became pale white to creamy in color, crumbly and surrounded by narrow zone of beta hemolysis as shown in (Figure 2B). Gram stain of the bacterial colonies showed Gram-positive pleomorphic, club-like bacilli as shown in (Figure 2C). Biochemical tests revealed that the isolates were urease and catalase positive.

 

 

 

Figure 2: Colony morphology and staining characteristics of C. pseudotuberculosis isolates from mediastinal lymph nodes of slaughtered sheep. Small white, dry and non-hemolytic colonies after 24 h (A) and colonies surrounded by narrow zone of β-hemolysis after 48 h (B). Gram stained smear showed Gram-positive pleomorphic bacilli (C).

The isolates were further confirmed by detection of pld gene specific for C. pseudotuberculosis. The results showed that DNA fragment of 203 bp for pld gene specific for C. pseudotuberculosis was amplified successfully in all samples as shown in (Figure 3).

 

 

 

Figure 3: Amplification of the pld genespecific for C. pseudotuberculosis isolated from CLA from carcasses of sheep. Lane 100bp: DNA ladder. Lanes 1-9: amplified pld gene in C. pseudotuberculosis isolates

 

Clinical signs of experimentally infected rabbits

Based on daily regular field observations on experimentally infected rabbits and control group, a rabbit was found dead after five days of oral infection. Postmortem inspection on the dead rabbit revealed a clear intestinal congestion, with yellow necrotic foci within the liver (Figure 4). The rest rabbits were suffered from inappetence and lethargy during first week post-infection, but were returned to normal condition and were in good appetite in a week after. Whereas, the control group that were kept under the same environmental condition during the whole period of the experiment were found in good body condition with no any clinical signs compared to the infected group.

 

 

 

Figure 4: Necrosis lesions (yellow arrows) in liver and congestion (red arrows) in intestine of dead rabbit after 5 day from oral infection with Corynebacterium pseudotuberculosis at 1x107 CFU/ ml.

 

At 10 days post-infection, the internal organs (lymph nodes, liver and spleen) of sacrificed rabbits (N=5) revealed clear enlargement and congestion mainly in spleen and mediastinal lymph nodes, and on the cut surfaces, caseo-purulent materials were found in lymph nodes (Figure 5).

 

 

Figure 5: Yellow arrows refer to (A) caseo-purulent materials from crushed lymph nodes by tip of electric miller, (B) prominent enlargement and congestion of liver, (C) enlarged mediastinal lymph node.

 

Post-infection bacterial isolation and bacterial loads

To determine the potential bacterial survival within the bodies of orally infected rabbits, liver, spleen and lymph nodes samples were randomly taken from scarified rabbits at different weight and homogenized then cultured on blood agar. Only three rabbits gave positive bacterial growth; the isolated bacterial CFUs where different between rabbits and between organs (Figure 6).

 

 

 

Figure 6: Corynebacterium pseudotuberculosis colony forming unit (CFU)/ ml retrieved from spleen, liver and lymph nodes samples of infected rabbits after 10 days (N=3); where the average weights of the used tissues for the bacterial isolation from spleen, liver and lymph nodes were (0.05 gm), (0.258 gm) and (0.081 gm) respectively.

 

Histopathological changes

Histopathologically, Hematoxylin and Eosin stained slides from spleen, liver and lymph nodes samples revealed foci of caseo-necrosis in center with presence of pus and surrounded by clear zones of pyogenic membrane infiltrated with leukocytic cells encapsulated by a thick wall of connective tissue (Figure 7)

 

 

Figure 7: Histopathological lesions of caseous lymphadenitis due to Corynebacterium pseudotuberculosis in infected rabbits after 10 days of experimental infection stained with (H&E x100). (A) Lymph node with caseated lesions; caseo-necrotic center surrounded by a thick pyogenic membrane infiltrated with leukocytic cells. (B) Liver of infected rabbit shows micro caseated lesion, (C) Higher magnification of the liver lesion reveals a high infiltration of leukocytic cells within the core of the abscess with the presence of the bacteria and surrounded by fibrotic cells (connective tissue). (D) Spleen of infected rabbit with caseo-necrotic lesions (yellow ring).

 

Discussion

 

The prevalence rate of CLA among sheep in Duhok area and the possibility of using rabbits as a model for in vivo studies on CLA were investigated in this study. The data revealed the prevalence rate of CLA among the slaughtered sheep was at 1.9% which is in line with that reported among the clinically infected adult sheep in Baghdad at rate 2.55% (7), and in India at rate 2.31% (26), in Turkey the prevalence rate of CLA among slaughtered sheep and goats was at 2.2% based on PCR (27).

The diagnosis of the suspected CLA was confirmed by laboratory diagnoses, the data revealed that all lymph nodes were positive for C. pseudotuberculosis because the primary target site for C. pseudotuberculosis replication is lymph nodes (27). Similar findings have been reported previously in sheep and goats using PCR detection of the bacteria from the lymph nodes by (28) and from lymph nodes of mice by (29). Based on standard microbiology methods including colony characteristics, Gram staining and biochemical tests all isolates showed the characteristics of C. pseudotuberculosis as mentioned by (30,31). However, there is variability in characteristics of the species within the Corynebacterium genus; consequently molecular technique such as PCR technique was developed to confirm the detection of the bacterium. For example, PCR based on 16S rRNA, RNA polymerase β-subunit (rpoB) and phospholipase D (pld) genes have been developed to identify C. pseudotuberculosis isolates (19,32). In this study, 20 phenotypic suspected isolates were subjected to the PCR using primer targeting specific pld gene of C. pseudotuberculosis and the amplification of pld gene of 203 bp showed that 100% of the tested isolates were positive C. pseudotuberculosis. The pld gene encodes the phospholipase D (PLD exotoxin) that implicates in the virulence of C. pseudotuberculosis. Detection of C. pseudotuberculosis from CLA in sheep and goat based on pld was also confirmed by (7,19,28).

The effect of the risk factors including age and sex of the infected sheep on the prevalence of the disease were determined; the older sheep found higher infection rate of CLA than that of younger ages, these finding are in accordance with that reported by (8,33). The older ages have more chances for exposure to the bacterial infection which escalates the infection rates of CLA (34-36). Increasing infection rate with ageprobably reflects greater exposure of the animals before slaughtering to risk factors such as shearing and contaminated dipping equipment (3,37), or may be due to animals fighting behavior with transmission through head wounds (38).

With regards to the gender, the data found that prevalence of the disease was higher in female than that of male; the higher rate in females could be due to the age of the animal, where females are kept for longer period than males for reproduction which increase the females exposure to predisposing factors such as shearing and contact with the infected animals (8). This means that ewes usually reared for older ages than rams (34). However, studies found different results (39), the higher susceptibility of the males to the infection could be due to the acute phase protein, mainly haptoglobin which is highly increased in male than that of females in response to Corynebacterium pseudotuberculosis. Increased levelsofhaptoglobin in sheep in response to the bacteria found to play roles in development of CLA (39,40).

This study was conducted to determine the potential uses of rabbits as a mode for in vivo studying of CLA following detection of the prevalence rate of the disease among the sheep and confirmation of the causative agent. The infected rabbits were clinically characterized by loss of appetite to anorexia, congregated, loss of body condition during first week post-infection, but later the animals returned to its normal appetite. These finding are in accordance with that reported in experimentally infected mice with Corynebacterium pseudotuberculosis (41). Furthermore, the bacteria reproduced CLA, namely in mediastinal and regional lymph nodes similar to that developed in sheep and goats as described (42).

Corynebacterium pseudotuberculosis was isolated after ten days of oral infection from the different organs (spleen, liver and lymph nodes) of infected rabbits at different rates. No study was found on rabbits to compare the present data with; C. pseudotuberculosis biovar ovis strain were isolated after 36 hr post-infection from spleen of mice after intraperitoneally injected with 106 CFU/ml (43). Besides, four different equine-origin Corynebacterium pseudotuberculosis strains C3H/HeJ were isolated from liver, spleen, lungs, and mesenteric lymph nodes of mice following intradermal injection (14). However, these studies used different routes of infection, evidence found that C. pseudotuberculosis systemic infection was irrespective of the route of administration in a study was done in guinea (13). In this study, the bacteria were only recovered from three rabbits, all rabbits were positive histopathologically for the presence of abscess and granulomas; this could be due to the host immune response killed the bacteria (22,44), but could not clear the abscess and the granuloma at the time-point post-infection which might be due the presence of phospholipase D (PLD) and mycolic acid of the dead bacteria maintained the granuloma development (15, 45).

To determine the potential development of CLA and pyogranuloma (in internal organs) in orally infected rabbits after a time point of 10 days post-infection, sections of selected organs were stained with H&E and evaluated on light microscopy. Caseo-necrotic foci with multiple micro-granulomas were found in liver, spleen and lymph nodes; micro-abscesses of caseo-necrotic center surrounded by a thick pyogenic membrane infiltrated with leukocytic cells were found mainly in lymph nodes. These findings are in accordance with that reported in in the lungs, liver and kidneys of orally infected mice with C. pseudotuberculosis (15). Microscopically, the granulomas were found within this study were similar to that reported in infected sheep and goats with CLA, where the abscess found with central necrotic area surrounded by pyogenic membrane with infiltration of inflammatory cells (46,47); however, no pathognomonic signs of CLA (onion ring signs) were found in this study, and this could be due to the time point post-infection where relayed in this study was not enough to develop the lamellated lymphadenitis which is chronic and needs time to be developed (48).

 

Conclusions

 

Taken together, the study found that the disease is prevalent among the sheep within the area; molecular and histopathological studies are recommended to be conducted for larger scales researches to determine the prevalence of the disease among the different areas of Duhok province. Preliminary data revealed that using of rabbits as an animal model to study pathogenesis of CLA is promising; further studies are recommended to be done, namely with regards to the interactions between the host and the pathogen in terms of immune response, to validate the potential uses of the animal for in vivo studies.

 

Acknowledgments

 

The authors would like to thank Collage of Veterinary Medicine staff for their supports and providing us with the required facilities to carry out this research work. Thanks to director of Duhok abattoir for providing facilities to collect samples from animals.

Conflict of Interest

 

No conflict of interest.

  1. Caseous lymphadenitis is an endemic disease among sheep in Duhok area.
  2. Molecular and histopathological studies are recommended to be conducted to determine the prevalence of the Caseous lymphadenitis among the small ruminant.
  3. Rabbits can be used as an animal model to study pathogenesis of CLA in vivo.
  • PDF (950 K)
  • XML
(2021). Prevalence and molecular investigation of caseous lymphadenitis among the slaughtered sheep at Duhok Abattoirs; experimental infection with Corynebacterium pseudotuberculosis in rabbits. Iraqi Journal of Veterinary Sciences, 35(2), 263-270. doi: 10.33899/ijvs.2020.126772.1377
Nawzat Issa; Rezheen Fatah; Zanan Taha; Muhammad Hussen; Kareem Kareem; Handren Hamadamin; Zirak Najeeb; Bahroz Ahmed; Hivi Hameed. "Prevalence and molecular investigation of caseous lymphadenitis among the slaughtered sheep at Duhok Abattoirs; experimental infection with Corynebacterium pseudotuberculosis in rabbits". Iraqi Journal of Veterinary Sciences, 35, 2, 2021, 263-270. doi: 10.33899/ijvs.2020.126772.1377
(2021). 'Prevalence and molecular investigation of caseous lymphadenitis among the slaughtered sheep at Duhok Abattoirs; experimental infection with Corynebacterium pseudotuberculosis in rabbits', Iraqi Journal of Veterinary Sciences, 35(2), pp. 263-270. doi: 10.33899/ijvs.2020.126772.1377
Prevalence and molecular investigation of caseous lymphadenitis among the slaughtered sheep at Duhok Abattoirs; experimental infection with Corynebacterium pseudotuberculosis in rabbits. Iraqi Journal of Veterinary Sciences, 2021; 35(2): 263-270. doi: 10.33899/ijvs.2020.126772.1377
  • RIS
  • EndNote
  • BibTeX
  • APA
  • MLA
  • Harvard
  • Vancouver

  1. Piotr L, Gryzińska M, Marcin M, Stephen P, Albrecht B, Malgorzata D. Caseous lymphadenitis in sheep in the falkland islands. Acta Vet Brno 2016;66(3):406-412. Doi: 10.1515/acve-2016-0034
  2. Washburn KE, Fajt VR, Lawhon SD, Adams LG, Tell LA, Bissett WT. Caprine abscess model of tulathromycin concentrations in interstitial fluid from tissue chambers inoculated with Corynebacterium pseudotuberculosis following subcutaneous or intrachamber administration. Antimicrob Agents Chemother. 2013;57(12):6295-6304. Doi: 10.1128/AAC.00936-13
  3. Williamson LH. Caseous lymphadenitis in small ruminants. Vet Clin North Am Food Anim Pract. 2001;17(2):1-5. Doi: 10.1016/S0749-0720(15)30033-5
  4. Minozzi G, Mattiello S, Grosso L, Crepaldi P, Chessa S, Pagnacco G. First insights in the genetics of caseous lymphadenitis in goats. Ital J Anim Sci. 2016;16(1):31-38. Doi: 10.1080/1828051X.2016.1250610
  5. Ranjithkumar M, Kamili NM, Saravanan M, Shivakumar MU, Dey S. Caseous lymphadenitis in a goat. Indian Vet J. 2012;89(2):66-67. Doi: 10.1111/j.1751-0813.1934.tb01036.x
  6. Sood NK, Sandhu BS, Gupta K, Narang D, Vasudeva K, Singh ND. Mesenteric caseous lymphadenitis in a cow calf caused by Corynebacterium pseudotuberculosis: A case report. Vet Med. 2012;57(7):371-375. Doi: 10.17221/6266-VETMED
  7. Al-badrawi TYG and Habasha FG. Bacteriological and Molecular Studies of Ovine Caseous lymphadenitis in Iraq. J Agri Vet Sci. 2016;9:46-51. Doi: 10.9790/2380-0905024651
  8. Ghazi Habasha F and Yassin Ghani Al-Badrawi T. Serological detection of caseous lymphadenitis in sheep using elisa in and outside Baghdad. Bas J Vet Res. 2016;15:208-213. [available here]
  9. Abebe D, Sisay TT. Determination of Corynebacterium pseudotuberculosis prevalence and antimicrobial susceptibility pattern of isolates from lymph nodes of sheep and goats at an organic export abattoir, Modjo, Ethiopia. Lett Appl Microbiol. 2015;61(5):469-476. Doi: 10.1111/lam.12482
  10. Othman AM, Abba Y, Jesse FFA, Ilyasu YM, Saharee AA, Haron AW. Reproductive pathological changes associated with experimental subchronic Corynebacterium pseudotuberculosis infection in nonpregnant boer does. J Pathol. 2016;2016:1-7. Doi: 10.1155/2016/4624509
  11. Santiago LB, Pinheiro RR, Alves FSF, Santos VWS dos, Rodrigues A de S, Lima AMC. In vivo evaluation of antiseptics and disinfectants on control of caseous lymphadenitis: Clinical, haematological, serological and microbiological monitoring. Arq Inst Biol. 2013;80(3):273-280. Doi: 10.1590/s1808-16572013000300003
  12. Mahmood ZKH, Jesse FF, Saharee AA, Jasni S, Yusoff R, Wahid H. Clinio-pathological changes in goats challenged with corynebacterium peudotuberculosis and its exotoxin (PLD). Am J Anim Vet Sci. 2015;10(3):112-132. Doi: 10.3844/ajavsp.2015.112.132
  13. Vaid J. Immune Responses to Corynebacterium pseudotuberculosis [PhD thesis]. Surrey: University of Surrey; 1988. [available here]
  14. Nieto NC, Foley JE, MacLachlan NJ, Yuan T, Spier SJ. Evaluation of hepatic disease in mice following intradermal inoculation with Corynebacterium pseudotuberculosis. Am J Vet Res. 2009;70(2):257-262. Doi: 10.2460/ajvr.70.2.257
  15. Latif NAA, Abdullah FFJ, Othman AM, Rina A, Chung ELT, Zamri-Saad M. Isolation and detection of Corynebacterium pseudotuberculosis in the reproductive organs and associated lymph nodes of non-pregnant does experimentally inoculated through intradermal route in chronic form. Vet World. 2015;8(7):924-927. Doi: 10.14202/vetworld.2015.924-927
  16. Hussein SA. Study of Staphylococcus aureus isolated from the mouth of canary. Iraqi J Vet Sci. 2020;34(2):301-304. Doi: 10.33899/ijvs.2019.125937.1192
  17. Assafi MS, Hado HA, Abdulrahman IS. Detection of methicillin-resistant Staphylococcus aureus in broiler and broilers farm workers in duhok, Iraq by using conventional and PCR techniques. Iraqi J Vet Sci. 2020;34(1):15-22. Doi: 10.33899/ijvs.2019.125757.1145
  18. da Conceição Aquino de Sá M, Gouveia GV, da Costa Krewer C, Veschi JLA, de Mattos-Guaraldi AL, da Costa MM. Distribution of PLD and FagA, B, C and D genes in Corynebacterium pseudotuberculosis isolates from sheep and goats with caseus lymphadenitis. Genet Mol Biol. 2013;36(2):265-268. Doi: 10.1590/S1415-47572013005000013
  19. Pacheco LGC, Pena RR, Castro TLP, Dorella FA, Bahia RC, Carminati R. Multiplex PCR assay for identification of Corynebacterium pseudotuberculosis from pure cultures and for rapid detection of this pathogen in clinical samples. J Med Microbiol. 2007;56(4):480-486. Doi: 10.1099/jmm.0.46997-0
  20. Miles AA, Misra SS, Irwin JO. The estimation of the bactericidal power of the blood. J Hyg. 1938;38(6):732-749. Doi:  10.1017/S002217240001158X  
  21.  Pépin M, Seow HF, Corner L, Rothel JS, Hodgson ALM, Wood PR. Cytokine gene expression in sheep following experimental infection with various strains of Corynebacterium pseudotuberculosis differing in virulence. Vet Res. 1997;28(2):149-63. Doi: 10.1016/S0928-4249(97)85253-4
  22. Aroch I, Harmelin A, Saran A, Levin D, Shpigel NY. Experimental Corynebacterium pseudotuberculosis mastitis in dairy cows. Vet Rec. 2003;153(24):746-750. Doi: 10.1136/vr.153.24.746  
  23. Al-Jammas S, Al-Saraj A. The histological changes induced by cytarabine on rabbits kidneys (with and without vitamin e administration). Iraqi J Vet Sci. 2019;33(2):311-316. Doi: 10.33899/ijvs.2019.162910
  24. Al-Hamdany MZ. Comparative anatomical, histological, and histochemical study of liver in human and domestic rabbit. Iraqi J Vet Sci. 2019;33(2):437-446. Doi: 10.33899/ijvs.2019.163193
  25. Cardiff RD, Miller CH, Munn RJ. Manual hematoxylin and eosin staining of mouse tissue sections. Cold Spring Harb Protoc. 2014;10:2-7. Doi: 10.1101/pdb.prot073411
  26. Kumar J, Tripathi BN, Kumar R, Sonawane GG, Dixit SK. Rapid detection of Corynebacterium pseudotuberculosis in clinical samples from sheep. Trop Anim Health Prod. 2013;45(6):1429-1435. Doi: 10.1007/s11250-013-0381-8
  27. Çetinkaya B, Karahan M, Atil E, Kalin R, De Baere T, Vaneechoutte M. Identification of Corynebacterium pseudotuberculosis isolates from sheep and goats by PCR. Vet Microbiol. 2002;88(1):75-83. Doi: 10.1016/s0378-1135(02)00089-5  
  28. Guerrero JAV, de Oca Jiménez RM, Acosta Dibarrat J, León FH, Morales-Erasto V, Salazar HGM. Isolation and molecular characterization of Corynebacterium pseudotuberculosis from sheep and goats in Mexico. Microb Pathog. 2018;117:304-309. Doi: 10.1016/j.micpath.2018.02.031
  29. Jesse FF, Adamu L, Osman AY, Muhdi AF Bin, Haron AW, Saharee AA. Polymerase chain reaction detection of c. pseudotuberculosis in the brain of mice following oral inoculation. Int J Anim Vet Adv. 2013;5(1):29-33. Doi: 10.19026/ijava.5.5571
  30. Dorella FA, Pacheco LGC, Oliveira SC, Miyoshi A, Azevedo V. Corynebacterium pseudotuberculosis: Microbiology, biochemical properties, pathogenesis and molecular studies of virulence. Vet Res. 2006;37(2):201-218. Doi: 10.1051/vetres:2005056
  31. Alves JRA, de Farias AE, dos Anjos, DM. Seroepidemiological study of caseous lymphadenitis in sheep from the Northeast region of Brazil using an indirect ELISA. Trop Anim Health Prod. 2020;52:1945-1952. Doi:  https://doi.org/10.1007/s11250-020-02214-9  
  32. Khamis A, Raoult D, La Scola B. rpoB gene sequencing for identification of Corynebacterium species. J Clin Microbiol. 2004;24(9):3925-3931. Doi: 10.1128/JCM.42.9.3925-3931.2004
  33. Kaba J, Nowicki M, Frymus T, Nowicka D, Witkowski L, Szaluś-Jordanow O. Evaluation of the risk factors influencing the spread of caseous lymphadenitis in goat herds. Pol J Vet Sci. 2011;14(2):231-237. Doi: 10.2478/v10181-011-0035-6
  34. Al-Gaabary MH, Osman SA, Oreiby AF. Caseous lymphadenitis in sheep and goats: Clinical, epidemiological and preventive studies. Small Rumin Res. 2009;87(1-3):116-121. Doi: 10.1016/j.smallrumres.2009.10.008  
  35. Chikhaoui M and Khoudja FB. Clinicopathological investigation on caseous lymphadenitis in local breed sheep in Algeria. Trop Anim Health Prod. 2013;45(7):1641-3. Doi: 10.1007/s11250-013-0410-7
  36. Ali A, Mahmoud A, Khadr A, Elshemey T, Abdelrahman A. Corynebacterium Pseudotuberculosis: Disease prevalence, lesion distribution, diagnostic comparison through microbiological culture and molecular diagnosis. Alexandria J Vet Sci. 2016;51(2):189-198. Doi: 10.5455/ajvs.219993
  37. Baird GJ, Fontaine MC. Corynebacterium pseudotuberculosis and its Role in Ovine caseous lymphadenitis. J Comp Pathol. 2007;137(4):179-210. Doi: 10.1016/j.jcpa.2007.07.002
  38. Nomi BS. Investigation for bacterial causes of superficial abscesses in Iraqi goats. 2016;15:51-53. Doi: 10.29079/vol15iss1art369
  39. Jeber ZKH, MohdJin Z, Jesse FF, Saharee AA, Sabri J, Yusoff R. Influence of Corynebacterium pseudotuberculosis infection on level of acute phase proteins in goats. BMC Vet Res. 2016;12:48. Doi: 10.1186/s12917-016-0675-y
  40. Eckersall PD, Lawson FP, Bence L, Waterston MM, Lang TL, Donachie W. Acute phase protein response in an experimental model of ovine caseous lymphadenitis. BMC Vet Res. 2007;3:35. Doi: 10.1186/1746-6148-3-35
  41. Othman AM, Abba Y, Jesse FFA, Ilyasu YM, Saharee AA, Haron AW. Reproductive pathological changes associated with experimental subchronic Corynebacterium pseudotuberculosis infection in nonpregnant boer does. J Pathol. 2016;1-7. Doi: 10.1155/2016/4624509
  42. Pépin M, Pardon P, Lantier F, Marly J, Levieux D, Lamand M. Experimental Corynebacterium pseudotuberculosis infection in lambs: Kinetics of bacterial dissemination and inflammation. Vet Microbiol. 1991;26:381-392 Doi: 10.1016/0378-1135(91)90031-A
  43. Silva WM, Dorella FA, Soares SC, Souza GHMF, Castro TLP, Seyffert N. A shift in the virulence potential of Corynebacterium pseudotuberculosis biovar ovis after passage in a murine host demonstrated through comparative proteomics. BMC Microbiol. 2017;17:55. Doi: 10.1186/s12866-017-0925-6
  44. Simmons CP, Dunstan SJ, Jachedjian M, Krywult J, Hodgson ALM, Strugnell RA. Vaccine potential of attenuated mutants of Corynebacterium pseudotuberculosis in sheep. Infect Immun. 1998;66(2):474-9. Doi: 10.1128/IAI.66.2.474-479  
  45. Khuder Z. Sex hormone profiles and cellular changes of reproductive organs of mice experimentally infected with C. pseudotuberculosis and its exotoxin phospholipase D (PLD). IOSR J Agric Vet Sci. 2012;1(3):24-29. Doi: 10.9790/2380-0132429
  46. Mira C, Fatima BK, Fadhela S, Kada K, Yacine T. Epidemiological and Histopathological Studies on caseous lymphadenitis in slaughtered goats in Algeria. Glob Vet. 2014;13:1065-1068. Doi: 10.5829/idosi.gv.2014.13.06.9182
  47. Zavoshti FR, Khoojine ABS, Helan JA. Frequency of caseous lymphadenitis (CLA) in sheep slaughtered in an abattoir in Tabriz: Comparison of bacterial culture and pathological study. Comp Clin Pathol. Doi: 2012;21:667-671. Doi: 10.1007/s00580-010-1154-7  
  48. Fontaine MC, Baird GJ. Caseous lymphadenitis. Small Rumin Res. 2008;76(s1-2):42-48. Doi: 10.1016/j.smallrumres.2007.12.025

  • Article View: 1,053
  • PDF Download: 489
  • LinkedIn
  • Twitter
  • Facebook
  • Google
  • Telegram
  • Home
  • Glossary
  • News
  • Aims and Scope
  • Privacy Policy
  • Sitemap

 

© 2023, College of Veterinary Medicine, University of Mosul

 
This journal is licensed under a Creative Commons Attribution 4.0 International (CC-BY 4.0)

Powered by eJournalPlus