Abstract
The present study was carried out to detect the genotype of E. histolytica that found in human fecal specimens and animals feces with Haemorrgic diarrhea by amplifying the SREHP gene, using RT-PCR technique, Cyber green dye and by fusion curve analysis. The study also included molecular detection of amoebic parasite species using Nested-PCR technology. The study recorded presence of parasites E. histolytica; E. dispar; E. bovis with total infection rates 82.9, 26.8, 4.9%, respectively. The study revealed the presence of E. histolytica parasite in five different genotypes (I, II, III, IV, V) with rate presence 9.75, 53.65, 19.5, 9.75, 7.3%, respectively. In conclusion, there are five genotype of E. histolytica, in human and animals, most of these genotypes may be infect any host, E. bovis was recorded in sheep and cows.
Main Subjects
Full Text
The genotype of Entamoeba histolytica in bloody diarrhea samples of humans, cows and sheep
H.H. Naser
Zoonotic Diseases Research Unit, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Qadisiyah, Iraq
Email: hassan.naser@qu.edu.iq
(Received September 25, 2019; Accepted January 20, 2019; Available online August 11, 2020)
Abstract
The present study was carried out to detect the genotype of E. histolytica that found in human fecal specimens and animals feces with Haemorrgic diarrhea by amplifying the SREHP gene, using RT-PCR technique, Cyber green dye and by fusion curve analysis. The study also included molecular detection of amoebic parasite species using Nested-PCR technology. The study recorded presence of parasites E. histolytica; E. dispar; E. bovis with total infection rates 82.9, 26.8, 4.9%, respectively. The study revealed the presence of E. histolytica parasite in five different genotypes (I, II, III, IV, V) with rate presence 9.75, 53.65, 19.5, 9.75, 7.3%, respectively. In conclusion, there are five genotype of E. histolytica, in human and animals, most of these genotypes may be infect any host, E. bovis was recorded in sheep and cows.
Keywords: Entamoeba spp., Real-Time PCR, SREHP, Genotyping, Melting curve analysis
DOI: 10.33899/ijvs.2020.126135.1242, ©2020, College of Veterinary Medicine, University of Mosul.
This is an open access article under the CC BY 4.0 license (http://creativecommons.org/licenses/by/4.0/).
النمط الجینی للأمیبا الحالة للنسجفی عینات الإسهال الدموی للإنسان والأبقار والأغنام
حسن حاجم ناصر
وحدة بحوث الأمراض الانتقالیة، کلیة الطب البیطری، جامعة القادسیة، القادسیة، العراق
الخلاصة
صممت الدراسة لتحدید النمط الجینی لطفیلی الامیبیا الحالة للنسیج E.hitolyticaالموجودة فی عینات الاسهال الدموی للإنسان والحیوان (الابقار والاغنام) باستخدام تقنیة تفاعل السلسلة المتبلمرة فی الوقت الحقیقی عن طریق تضخیم الجین SREHP واستعمال صبغة السایبر الخضراء. شملت الدراســة ایضا تقنیة Nested-PCR لتحدید انواع طفیلی الامیبیا. سـجلت الانواع E. histolyticaوE. Dispar و E. bovisمن مجموع الاصابات بنسبة 82,9 و 26,8 و 4,9% على التوالی. وجدت خمس انماط جینیة للامیبیا الحالة للنسیج I وII و III و IV و V بنسبة 9,75 و 53,65 و 19,5 و 9,75 و 7,3 على التوالی. استنتجت الدراسة هناک خمس انماط جینیة للامیبیا الحالة للنسیج فی الانسان والحیوان معظمها قد تصیب ای مضیف، تسجیل E.bovis فی الابقار والاغنام.
Introduction
Many species of amoeba genus were identified in the first quarter of the twentieth century (1) and are spread in various regions of the world in the developing countries of the Indian subcontinent, Central and South America, and in the tropics of Africa (2), as well as many species that parasitize many hosts, some of which are common to more than one host (3).
The parasite has the ability to devour red blood cells by Erythrophagocytosis through the process of analyzing its plasma membrane and then digesting the base material, as the ability of the feeding phases to digest erythrocyte may be due to the mechanism of adhesion to the surfaces of the cells and inhibit the adhesion of the parasite decreases phagocytosis and digestion of the erythrocytes during the parasite invasion of the large intestine layers (4), attributed (5) to (Hemoglobinase) and for the need of iron for the survival of the parasite, hence, the digestion of blood hemoglobin to get iron (4,5). The ability of (E. dispar) to cause liver injury, and some studies taken from the comparison of the genetic structure of both species (dispar and histolytica) have concluded that some sites of the gene responsible for the encoding of certain proteins of pathogenicity in the E. histolytica are the same in the E. dispar such genes as the amoebic hole Gal / GalNac-inhibitable lectin. (6,7).
In the presence of E. histolytica and E. bovis as single infection indicating that these parasites can shift from a coexistence with the host to pathogenicity (5), many studies have returned (and until recently) that have attempted to differentiate between E. histolytica infection and its cause, from invasions of tissues into and out of the intestine and between the infectious of E. dispar and other parasites, even those studies were considered unsatisfactory (8). This hypothesis is offset by recent studies that, using experimental animals, have demonstrated the events of the parasite E. dispar for focal ulcers and have an analytical capacity of the epithelial layer (9). performance development of a parasite which isolated from a person with no symptoms of amoebiasis in a medium containing intestinal flora, it was observed endemicity of amoebiasis taking into account the overlap between the two parasites and pathogenic bacteria or intestinal flora, which may alter the behavior of these organisms into a nurse, since some pathogenic bacteria have genes that directly or indirectly encoded molecules activated by the inflammatory response (10).
Materials and methods
Samples collection
A 34 human samples from Al-Hamza General Hospital and twenty eight animals samples were collected from different areas of Al-Hamza district, the presence of the parasite was confirmed in all samples by general stool examination via microscopic examination in the laboratories of the parasitology and microbiology branch in the College of Veterinary Medicine - Al-Qadisiyah University.
Stool DNA extraction
DNA was extracted from fecal samples using the Genomic DNA stool (AccuPrep® Stool DNA Extraction Kit) supplied by Bioneer Korean company according to the manufacturer instructions. This kit was designed to quickly and conveniently extract of DNA from genomic DNA from microorganisms in stool samples. In the presence of chaotropic salt, DNA is bound to glass fibers fixed in a column. Proteins and other contaminants are removed through washing stems, and the DNA isolated and eluted in the final elution step.
Nested PCR method
Nested PCR assay was performed detection E. histolytica and E. dispar according to (11), and E. bovis according to (12), the Nested PCR method was including using primary PCR primers for detection Entamoeba sp. Followed by Nested PCR primers that used for detection of E. histolytica, E. dispar, and E. bovis (Table 1).
The first round of Nested PCR master mix that include Entamoeba sp. Primary primers were prepared by using (AccuPower® PCR PreMix Kit, Bioneer, Korea) (Table 2).
Table 1: Nested PCR primers
Primer |
Sequences (5'-3') |
Product size |
|
Entamoeba sp. |
F |
TTTGTATTAGTACAAA |
~900bp |
R |
GTAAGTATTGATATACT |
||
E. histolytica |
F |
AATGGCCCATTCATTCAATG |
550bp |
R |
TTTAGAAACAATGCTTCTCT |
||
E. dispar |
F |
GAGGATCCATGTTCGCATTTTTATTGT |
729bp |
R |
GAGGATCCTTAGAAGACAATTGCCA |
||
E. bovis |
F |
AAACTGCGGACGGCTCATTA |
174bp |
R |
CGCGGCATCCTTTTTCACAA |
After that, these PCR master mix components that mentioned in table above placed in standard PCR PreMix Kit that containing all other components which needed to PCR reaction such as (Taq DNA polymerase, dNTPs, Tris-HCl pH: 9.0, KCl, MgCl2, stabilizer, and tracking dye). Then, all the PCR tubes transferred into Exispin vortex centrifuge at 3000rpm for 3 minutes. The reaction was performed in PCR thermocycler (T100 thermal cycler BioRad. USA) by set up the following thermocycler conditions; Reactions were performed using the following protocol, initial denaturation at 95ºC for 4 min, and 35 cycles at 95ºC for 1 min, 47ºC for 1 min and 72ºC for 2 min, and a final incubation at 72ºC for 7 min.
The second round Nested PCR master mix that include E. histolytica, E. dispar, and E. bovis primers were prepared by using (AccuPower® PCR PreMix Kit, Bioneer, Korea) (Table 3).
Table 2: PCR master mix
First round PCR master mix |
Volume |
DNA template 5-50ng/µL |
5µL |
Entamoeba sp. Primary forward primer |
1µL |
Entamoeba sp. primary reverse primer |
1µL |
PCR water |
13µL |
Total volume |
20µL |
Table 3: Nested PCR master mix
Nested PCR master mix |
Volume |
First round PCR product |
2µL |
Second round E. histolytica, or E. dispar, and or E. bovis Forward primer (10pmol) |
1µL |
Second round E. histolytica, or E. dispar, and or E. bovis Reverse primer (10pmol) |
1µL |
PCR water |
16µL |
Total volume |
20µL |
After that, these Nested PCR master mix component that mentioned in table above placed in same PCR PreMix Kit Then, all the PCR tubes transferred into Exispin vortex centrifuge at 3000rpm for 3 minutes.
The reaction was performed in PCR thermocycler (T100 thermal cycler BioRad. USA) by set up the following thermocycler conditions; Reactions were performed using the following Nested PCR protocol, initial denaturation at 95ºC for 4 min, and 35 cycles at 95ºC for 1 min, (50ºC for E. histolytica, 60ºC for E. dispar, 57ºC for E. bovis) for 1 min and 72ºC for 1 min, and a final incubation at 72ºC for 1 min.
After that PCR products were examined by electrophoresis in a 1% agarose gel, stained with ethidium bromide, and visualized under UV Transilluminator.
Real-Time PCR method
Real-Time PCR was performed genotyping of E. histolytica based on allelic discrimination during melting curve of SREHP gene in positive E. histolytica according to (13) the method was firstly included PCR reaction for amplification of SREHP gene based on SREHP primer (Table 4).
The Real-Time PCR amplification reaction was done by using (AccuPower® Green StarTM qPCR PreMix kit, Bioneer. Korea) and the qPCR master mix were prepared for each sample according to company instruction (Table 5).
After that, these RT PCR master mix components that mentioned in table above was transferred into Green star qPCR premix standard plate tubes that contain the SYBER green dye and other PCR amplification components.
Then the plate mixed by Exispin vortex centrifuge for 3 minutes, then placed in MiniOpticon Real-Time PCR system and applied the following thermocycler conditions (Table 6).
Table 4: PCR and RT-PCR primers (SREHP) for E. histolytica as (12)
Primer |
Sequences (5'-3') |
Product size |
|
PCR-SREHP |
F |
GCTAGTCCTGAAAAGCTTGAAGAAGCTG |
549bp |
R |
GGACTTGATGCAGCATCAAGGT |
||
RT PCR-SREHP |
F |
TATTATTATCGTTATCTGAACTACTTCCTG |
450bp |
R |
TGAAGATAATGAAGATGATGAAGATG |
Table 5: RT PCR master mix
RT PCR master mix |
Volume |
SREHP gene PCR product |
2µL |
RT PCR-SREHP gene forward primer |
1µL |
RT PCR-SREHP gene Reverse primer |
1µL |
PCR water |
16µL |
Total volume |
20µL |
Table 6: RT PCR master mix
qPCR step |
Temperature |
Time |
Cycle |
Initial Denaturation |
95 °C |
3 min |
1 |
Denaturation |
95 °C |
10 sec |
45 |
Annealing\ Extension |
55 °C |
30 sec |
|
Detection |
|||
Melting |
60-95°C |
0.5 sec |
1 |
Statistical analysis
The data were analyzed statistically to obtain the percentage and extract the Chi-square value (χ2).
Results
The study recorded a total infection rate 66.1% where 41 samples showed a positive result by microscopic examination (Table 7). Percentage of infection was detected by using Nested PCR.
Table 7: Percentage of total infection using Nested PCR
Samples |
Positive samples |
Negative sample |
||
No. |
Percent% |
No. |
Percent% |
|
Human |
24 |
38.7 |
10 |
16.1 |
Cows |
9 |
14.5 |
5 |
8 |
Sheep |
8 |
12.9 |
6 |
9.7 |
Total |
41 |
66.1 |
21 |
22.8 |
The study recorded the percentage of total infection with E. histolytica amounted to 79.1; 100; 75 (Figure 1) and E. dispar by 33.3; 22.2; 12.5 (Figure 2) in human, cows and sheep feces respectively, and E. bovis by 0; 11.1; 12.5 (Figure 3) in cattle and sheep, respectively (Table 8).
Table 8: Percentage of total infection by Nested PCR
Samples |
E. histolytica |
E. dispar |
E. bovis |
|
Human (24) |
n |
19 |
8 |
0 |
% |
79.1 |
33.3 |
0 |
|
Cows (9) |
n |
9 |
2 |
1 |
% |
100 |
22.2 |
11.1 |
|
Sheep (8) |
n |
6 |
1 |
1 |
% |
75 |
12.5 |
12.5 |
|
Total (41) |
n |
34 |
11 |
2 |
% |
82.9 |
26.8 |
4.9 |
The study showed the presence of the three parasites in the animals' samples, while the human samples were free from the presence of the parasite E. bovis (Table 8). The study showed significant effect of parasite type in the occurrence of infection with erythrocytes (F = 4.46), significant difference in the incidence between E. histolytica and E. bovis only where the animal type did not show significant effect (F = 0.848) at significant level P ≥ 0.05.
Genotypes of E. histolytica results
Genotypingof E. histolytica based on the Melting curve analysis that to detect the by Real-Time PCR assay based on amplification of SREHP gene by SYBER green dDNA binding dye which can differentiate melting temperatures (Tm) for each genotype 41. The Real-Time PCR Melting analysis results showed the presence of 5 different melting temperatures 79, 81, 82, 83, 84ºC of the SREHP gene for parasites (Figure 4). Each one melting temperature face one genotype 5 genotypes of E. histolytica were distributed as follows I, II, III, IV, V which corresponds to the melting temperatures 79, 81, 82, 83, 84ºC respectively, where genotypes were present 9.75, 53.65, 19.5, 9.75 and 7.3, respectively (Figure 5) (Table 9).
Table 9: Genotypes of E. histolytica based on melting temperature Tm
Total |
Melting Tm. |
Genotype |
No. |
% |
41 |
84 |
I |
4 |
9.75 |
83 |
II |
22 |
53.65 |
|
82 |
III |
8 |
19.5 |
|
81 |
IV |
4 |
9.75 |
|
79 |
V |
3 |
7.3 |
The relationship between the genotypes of E. histolytica and the presence of erythrocytes
The results showed that the presence of genotypes recorded in this study and found in fecal samples containing red blood cells was the following, where genotype II was more (22 out of 41). Genotype V was the least present in the total samples as it was found in only three samples, which was not found in cattle and sheep samples, whereas the study recorded the appearance of the five genotypes in human fecal samples (Table 10).
Table 10: Distribution of genotypes among hosts
Genotype |
Human |
Cows |
Sheep |
|||
No. |
% |
No. |
% |
No. |
% |
|
I |
3 |
7.3 |
1 |
2.4 |
0 |
0 |
II |
13 |
31.7 |
3 |
7.3 |
6 |
14.6 |
III |
3 |
7.3 |
4 |
9.75 |
1 |
2.4 |
IV |
2 |
4.8 |
1 |
2.4 |
1 |
2.4 |
V |
3 |
7.3 |
0 |
0 |
0 |
0 |
Total |
24 |
|
9 |
|
8 |
|
Figure 1: Electrophoresis in the agarose gel of products (550bp) PCR of rRNA for E. histolytica.
Figure 2: Electrophoresis in the agarose gel of products(729bp) PCR of rRNA for E. dispar.
Figure 3: Electrophoresis in the agarose gel of products (174bp) PCR of rRNA for E. bovis.
Figure 4: Different types of melting temperature peak for SREHP gene in E. histolytica
Figure 5: Melting curve for SREHP gene
Discussion
The study recorded the presence of E. histolytica and E. dispar in Humans, cows and sheep samples, indicating the possibility of transmission of these parasites between humans and animals (14) However, the incidence of infection with amoeba parasites in these animals or their functioning as potential reservoirs remains unclear. It is known that these parasites are transmitted through contaminated food and water where unhealthy habits, culture and use of contaminated water are considered. Irrigating crops, watering animals or using human and animal waste in agriculture help spread and transmission of the parasite among different hosts (15).
The presence of E. bovis in the host (cows) and in other hosts other than the usual (sheep), where previous studies confirmed the possibility of the presence and isolation of the parasite from other ruminants non-cattle such as deer and sheep may be due to the use of contaminated water for watering animals or the use of the same areas for grazing, which facilitates the transmission of parasites between them (16).
The results showed the high incidence of E. histolytica, which confirms the high ability of the parasite to analyze and devour the cells of tissues and red blood cells inside and outside the intestines (17) because they have enzymes analyzing the intestinal mucosa (8). The presence of E. dispar in humans may indicate a high pathogenicity of the parasite taking into account the presence of mixed infection with tissue-amoeba and the presence of a single infection of the parasite. The presence of other pathogens or auxiliary to the symptoms of infestation (15).
The presence of the parasite E. bovis even if only a small percentage confirms the ability of the parasite to cause infection even if the presence of another pathogen as a common infection.
The appearance of different genotypes reflecting the different melting temperatures of SREHP gene amplification products showed the large diversity in the nucleotide sequences and the content of the gene, reflecting a wide phenotypic variation of the genotype (II). Reflects the high ability of this genotype to spread and move among different hosts, especially with its presence in all hosts, Unlike Genotype V, which has the lowest ratio among all hosts (18).
The study showed the presence of four genotypes in human and cows feces in varying proportions, which the possibility of this genotype and its ability to be transmitted between humans and cows, genotype (V) which didn’t appear in sheep samples, may mean that these genotypes cannot infect sheep during the period of collection time of samples.
The study showed the presence of genotype V with the lowest presence rate, which means that the ferocity of this genotype is low and its ability to infect is lower than the other genotypes. In cows as a host of the parasite.
The broad spectrum of genotypes that have emerged during the study and the appearance of some genotypes with the presence of erythrocytes in fecal samples may indicate the virulence of these genotypes and their ability to invade tissues and cause disease, but do not reveal the role of other pathogens. In the intestine, parasite virulence was observed to be proportional to ambient conditions outside the intestine, which may indicate significant variations in the parasite metabolism directly or indirectly.
Conclusion
There are five genotypes of E. histolytica, in human and animals, most of these genotypes may infect any host, E. bovis was recorded in sheep and cows.
Acknowledgements
The authors are grateful to Members Zoonotic Diseases Research Unit, College of Veterinary Medicine for part sponsorship of this study.
Conflict of interests
The Parasitology Department College of Veterinary Medicine for development and evaluation of
Diagnostic tools.